Cloning and Expression Analysis of the Stable Antimicrobial Peptide
Gene from Citrus Junos 'Pujang Xiangcheng'
Shu Luo
1
, Ximeng Lin
1
, Xiaorong Wang
2
, Haoru Tang
2
and Qing Chen
1,*
1
College of Horticulture, Sichuan Agricultural University, Chengdu 611130, China
2
Institute of Pomology and Olericulture, Sichuan Agricultural University, Chengdu 611130, China
*
Keywords: Huanglongbing, Citrus Junos 'Pujiang Xiaocheng', Antimicrobial Peptide.
Abstract:
Citrus Huanglongbing (HLB) is a devastating disease which threatens the worldwide citrus industry. No
effective curable measurement could be taken to deal with the diseases to date. The recent exciting report
discovered a novel stable antimicrobial peptide (SAMP) in the HLB resistant citrus material. This SAMP
could provide protective effect as well as treatment effect in citrus materials. In the present study, we cloned
the CjSAMP coding gene in the newly released citrus stocks variety 'Pujiang Xiangcheng' (Citrus junos)
referring to the genetic information in the C. sinensis genome. Sequence analysis revealed that the gene
produced three kinds of isoforms due to alternative splicing. These three transcripts varied in length and could
produce three types of proteins. Structural analysis revealed that none of these proteins could produce the
effective 'coiled coil' based pore-like structure that has anti-microbial activity, indicating that 'Pujiang
Xiangcheng' was not a citrus type with extreme HLB tolerance. Expression analysis was further carried out
in five commonly used local stock varieties in the production application, including C. junos 'Pujiang
Xiangcheng', 'Ziyang Xiangcheng', Poncirus trifoliata, citrus hybrid (P. trifoliata × Citrus sinensis) and a C.
grandis. Real time quantitative PCR results indicated that C. grandis was the one with most tolerant ability,
while 'Pujiang Xiangcheng' was the least tolerant one, in consistent with the protein structure prediction
results.
1 INTRODUCTION
Citrus Huanglongbing (HLB), or citrus greening, is
one of the most devastating diseases threatening the
worldwide citrus industry (Dala-Paula, 2018). It was
acknowledged that species of Candidatus
Liberibacter (CL), was the causal agent for this
disaster (Achor, 2020; da Graça, 2016). A total of
three species, Ca. L. africanus (CLaf), Ca. L.
americanus (CLam) and Ca. L. asiaticus (CLas) were
identified which causes the spread of diseases in
different regions of citrus production worldwide. To
date, no curation methods were found to deal with the
trees once being infected. The main strategies in
coping with these problems include wiping out all
infected trees, controlling the diseases transmitting
insect citrus psyllid with chemicals, and using
diseases-free seedlings. However, none of these
*
Correspondence
measures could reduce the loose of fruit growers.
Moreover, antibiotics were used hoping to kill the
bacterium (Hu, 2018) but raising the environmental
and health concerns. To finding out resistance or
extremely tolerant resources was among the most
promising ways to fighting with this disease.
The recent reports suggested that the immune
system disorder was the main reason of damaging
effect of HLB diseases (Ma, 2022). The arm race
between plants and the pathogen have triggered
various plant immune system components.
Antimicrobial peptide (AMP) was among one of
them. Most of the time, these AMPs directly target
the cell wall, plasma membrane or organelles inside
the cell to prevent the invading (Huan, 2020). In
2021, Huang and colleagues from university of
California reported the findings of an endogenous
short peptide, named stable antimicrobial peptide
(SAMP) in HLB tolerant citrus resources (Huang,
Luo, S., Lin, X., Wang, X., Tang, H. and Chen, Q.
Cloning and Expression Analysis of the Stable Antimicrobial Peptide Gene from Citrus Junos ’Pujang Xiangcheng’.
DOI: 10.5220/0012020600003633
In Proceedings of the 4th International Conference on Biotechnology and Biomedicine (ICBB 2022), pages 329-334
ISBN: 978-989-758-637-8
Copyright
c
 2023 by SCITEPRESS – Science and Technology Publications, Lda. Under CC license (CC BY-NC-ND 4.0)
329

2021). This peptide coding gene expressed extremely
higher in tolerant citrus materials than that in the
HLB-sensitive resources. Further experiments
confirmed that the produced SAMP could recover and
maintain the resistance of sweet orange trees to the
CLas infection. This positive effect was attributed to
the second alpha helix formed in the SAMP protein,
which could break the bacterial cells using its pore-
like structure (Huang, 2021). Although the detail
genetic information of SAMP in citrus was not
thoroughly investigated so far, it was a very
promising way to find out resistant citrus or related
resources with similar mechanism.
In this study, we firstly cloned and identified the
SAMP gene in a currently released citrus root stock
'Pujiang Xiangcheng' (C. junos) by our group
(Xiaoke, 2017). Different transcripts of the same gene
were found. Structure of each protein produced by
each transcript was predicted. Lastly, the expression
of the SAMP gene was analyzed in five commonly
used root stock varieties.
2 MATERIALS AND METHODS
2.1 Plant Materials
The new citrus root strock 'Pujiang Xiangcheng'
variety released by our group (Xiaoke, 2017) was
used as starting materials for gene cloning. One year
old seedlings from seeds were grown in plastic
containers (5L in volume) with mixture of field soil
and peat moss (3:1, v: v), irrigating at a half-month
interval and fertilizing every month. Young leaves
with light green color were collected for DNA and
RNA isolation. The other widely used citrus root
stock verities including C. junos 'Ziyang
Xiangcheng', Poncirus trifoliata, citrus hybrid (P.
trifoliata × C. sinensis) and C. grandis were grown in
the field of the research center of Sichuan
Agricultural University at Congzhou city of Sichuan
Province. All leave materials for gene expression,
including those from 'Pujiang Xiangcheng' were
collected at the field. These resources were all grown
in the second year after seeds sowing. To make the
results comparable among species, fully expanded
and hardy leaves at almost the same position from
four sides of the tree canopy were collected from each
species. Samples were snap-frozen in liquid nitrogen,
transported to the lab and stored in a -80 °C
refrigerator before use.
2.2
Gene Cloning and RT-qPCR
Genomic DNA of 'Pujiang Xiangcheng' was isolated
using a modified CTAB method. Three percent of
CTAB were used here instead of 2%, in combination
with 1% beta-mercaptoethanol. Gene specific primers
were designed using the SAMP gene of C. sinensis
referring to the citrus genome
(https://www.citrusgenomedb.org/). Amplification of
the complete genomic sequence of the CjSAMP gene
was carried out in a 20 μL PCR reaction system,
consisting of 50 ng DNA, one pmol of both forward
and revers primers (Table 1, P1 and P2) and 10 μL of
CloneAmp HiFi PCR Premix (TaKaRa, Dalian,
China). Thirty circles of regular three-step PCR
reaction were carried out on a PTC-100 thermal
cycler system (BioRad, US). Total RNA of the leaves
was extracted using a commercial kit (TianGen,
Beijing, China) following the manufactures' protocol.
The first strand cDNA was synthesized by using the
RevertAid™ H Minus Reverse Transcriptase
(Thermo, US). Similar PCR reaction conditions were
used as amplifying the genomic coding sequence
except that 1 μL of cDNA was used as templates
(Table 1). All amplicons were detected by
electrophoresis in a 1% agarose gel. The specific
bands on the gel were purified using the E.Z.N.A.®
Gel Extraction Kit (OMEGA, US) as indicated by the
instruction. The DNA fragment were ligated into the
pEASY-blunt vector (TransGen, Beijing, China) and
transformed into the competent cells of Trans-T1
(TransGen, Beijing, China) using a heat-shock
method. Ten resistant clones were sequenced to
identify the inserted fragments.
To compare the relative expression level of the
CjSAMP gene in different citrus root stock varieties,
RT-qPCR was employed. To make the results
comparable to the previous reported results (Huang,
2021), the same specific gene primer pair were used
(qSAMPF and qSAMPR in Table 1). This pair of
primers could target to all three obtained transcripts,
hence reflecting the overall expression level of the
SAMP gene. The PCR reaction system were
constructed by combining 1 μL of cDNA template, 1
μL of the forward and revers primer, and 10 μL of TB
Green Premix Ex Taq II premixture (TaKaRa, Dalian,
China). The qPCR reaction was done on a CFX96
system (BioRad, US) using a standard two step
reaction protocol. The citrus ubiquitin gene (UBI,
UbiF and UbiR in Table 1) were used as internal
reference. The expression differences were expressed
as the deferential threshold cycles between the SAMP
gene and the UBI gene.
ICBB 2022 - International Conference on Biotechnology and Biomedicine
330

Table 1: Primers used in this study.
Primer Name Sequence (5'- 3')
P1 ATGGAAGAAGCTAAAGGAGTGGTGAAG
P2 CCTACTAGTACAACTCAGACACGTACTG
P4 ATGCTCACATTCTTGCCCTTATACTTAACA
P3 GTTACTGGCTGTTAAGTATAAGGGCAAG
P5 GTCTTTCCAATGGTCTCCCATTTGC
P8 CAATAGTCAAGGGTGTATCCACTTGTGAT
P7 ATCACAAGTGGATACACCCTTGACTATTG
P6 GCAAATGGGAGACCATTGGAAAGAC
qSAMPF AACAGGGGCAAGAATGTGAGCAT
qSAMPR ACACGTACTGTTGTCGGTTTGTAGTCA
UbiF ACCATCGACAATGTCAAGGC
UbiR CCTTTTGGATGTTGTATTCGGC
2.3 Bioinformatic Analysis
The vector sequences were trimmed in the Geneious
Prime suite (v2021.02). The splicing junction of the
introns of the CjSAMP gene were obtained by
aligning the cDNA sequences to the DNA sequences
of the gene. The deduced protein sequences were
searched against the non-redundant nucleotide
database at NCBI using BLASTP with e-value 1e-10.
Closely related gene sequences ranking in the top 10
hits were used to construct the phylogenetic tree.
Protein sequences were aligned using the mafft
software (v7.123b) and the tree was reconstructed
using the IQTREE package (v1.6.8). The optimal
protein substitution model 'LG+I' was selected during
this process. Fast bootstrap procedures were repeated
10000 times to validate the branch topology of the
tree.
3 RESULTS AND DISCUSSIONS
3.1 The Three Different SAMP
Transcripts
In the C. sinensis genome, three different alternative
splice products were annotated (Xu, 2013). Based on
the results of Huang et al., (Huang, 2021), only the
short SAMP could contribute to the resistance of
HLB diseases. Since the genome sequences of the C.
junos genome were still lacking, one pair of gene
specific primer were designed flanking the start and
stop codon of the longest SAMP transcript (Fig. 1A,
P1 and P2). Amplification of the gene using DNA
template presented us a unique and specific band
corresponding to 1000 bp in length. When using
cDNA as template, it produced a fragment about 340
bp (Fig. 1B lane 2). A DNA band with higher
molecular could be observed as well. Sanger
sequencing results indicated that the sharp and clear
one was the longest transcripts coding for a protein of
109 amino acids (Fig. 1C). Two single nucleotide
polymorphism sites were found when comparing with
the SAMP gene in the C. sinensis, producing two
different residuals correspondingly. Using the primer
combination of P1 and P4, P3 and P2, we could still
be able to amplify two products (Fig. B, lane 5 and 6).
This indicated that an alternative transcript
corresponding to the SAMP-t2 was exist. Using the
three pairs of primer (P5 and P2, P8 and P2, P1 and
P7), we were able to amplify a corresponding product
with expected size (Fig. 1, lane 3, lane 7 and lane 4).
Sequencing results demonstrated that due to the
intron retention, a premature termination codon
(PTC) was introduced to the transcripts of SAMP-t2,
leading to a production of a truncated protein with 55
amino acids in length (Fig. 1A). Likewise, the
alternative 3' splicing site selection in the exon1 also
brought a PTC mutation to the transcripts in SAMP-
t3, producing a 66 amino-acid peptide.
Cloning and Expression Analysis of the Stable Antimicrobial Peptide Gene from Citrus Junos ’Pujang Xiangcheng’
331

Figure 1: Amplification of the SAMP transcripts with specific primers and the coding sequences of CjSAMP1.
(Primer binding sites in the three transcripts (A)
and the gel electrophoresis detection results of
amplicons (B). The standard DNA marker was loaded
in lanes M. Lane 2 to 7 were corresponding to
products of the combination of primer pair P1+P2,
P5+P2, P1+P7, P1+P4, P3+P2, P8+P2. The coding
sequences of SAMP1 and the deduced amino acids
were arranged in accordance with their site number
(C). The SNP sites and the alternative amino acids in
C. junos comparing with C. sinensis were marked
with red and blue colour respectively)
3.2
The SAMP Structure and
Expression Analysis in Different
Root Stocks
Using the obtained protein sequences, we searched
the homologs of SAMP in the public protein database
to have an overview of the conserveness of the
protein. Several homologs with high sequence
identity (>90%) were obtained in different species.
The protein sequences with the top 10 hit score were
downloaded. Multi-sequence alignment indicated
several highly conserved amino acid residuals,
especially at the C- terminal of the protein (Fig. 2B).
Phylogenetic analysis revealed that the gene tree was
in consistent to the species relationship (Fig. 2A),
indicating an old origin of the gene in these
investigated species (Salse, 2016). Genetic distances
estimated among the proteins also supported that the
proteins were highly conserved. The largest genetic
distances were observed between the Ziziphus jujuba
and Fragaria vesca subsp. vesca (0.402).
Figure 2: Phylogeny (A), conserved residuals (B) of the SAMP1 protein.
ICBB 2022 - International Conference on Biotechnology and Biomedicine
332

Since the active antibacterial peptide should form
a pore-like structure (Huang, 2021), we used the
AlphaFold system (Jumper, 2021) to predict the
structure of all three proteins and compared to that
reported in the functional SAMP in citrus resistant
resources (Huang, 2021). Results indicated that the
protein formed a ternary structure with three helix and
four beta-sheet with high confidence (Fig. 3A). The
second functional helix in the reported SAMP was
corresponding to the third helix in this SAMP1
protein. However, the special occupation of the first
helix might hinder the formation of the pore-like
structure from interacting with multiple monomers. In
this regard, C. junos 'Pujiang Xiangcheng' does not
code for an active antipathogenic SAMP peptide in
the genome. Hence, it might not be highly tolerant
with HLB, if it would use the same SAMP resistance
mechanism. The other two proteins encoded by the
alternative spliced transcripts truncated in the N
terminal (Fig.3 A and B). They all lack the helix
structures. In consistent to these results, the
expression of the SAMP gene in this species was the
lowest among the investigated five root stocks (Fig.
2B). The maximum expression level was observed in
C. grandis.
Figure 3: The truncated protein sequences of the transcript t2 and transcript t3 (A and B) of the same SAMP gene, SAMP1
protein structure (C) and the relative expression level of the gene in different citrus stock resources (D).
4 CONCLUSION
We cloned the SAMP coding gene from the C. junos
root stock 'Pujiang Xiangcheng'. The gene produced
three different splicing products. Structure of the
identified CjSAMP1 formed four beta-sheet and three
alpha-helixes, most likely not being able to form a
pore-like structure. The transcripts abundance was the
lowest in the investigated citrus root stock resources
Cloning and Expression Analysis of the Stable Antimicrobial Peptide Gene from Citrus Junos ’Pujang Xiangcheng’
333

in 'Pujiang Xiangcheng'. It was not likely a HLB
extreme tolerant material based on these results.
ACKNOWLEDGMENTS
This work was financially supported by the Key
Research and Development Program of Science and
Technology Project of Chengdu City, Sichuan
Province (2019-YF05-00635-SN).
REFERENCES
Achor, D., Welker, S., Ben-Mahmoud, S., Wang, C.,
Folimonova, S.Y., Dutt, M., Gowda, S., Levy, A.
(2020) Dynamics of Candidatus Liberibacter asiaticus
movement and sieve-pore plugging in citrus sink cells.
Plant Physiol., 182: 882-891.
Dala-Paula, B.M., Plotto, A., Bai, J., Manthey, J.A.,
Baldwin, E.A., Ferrarezi, R.S., Gloria, M.B.A. (2018)
Effect of huanglongbing or greening disease on orange
juice quality, a review. Front. Plant Sci., 9: 1976.
Da Graça, J.V., Douhan, G.W., Halbert, S.E., Keremane,
M.L., Lee, R.F., Vidalakis, G., Zhao, H. (2016)
Huanglongbing: An overview of a complex
pathosystem ravaging the world's citrus. J. Integr. Plant
Biol., 2016. 58: 373-87.
Hu, J., Jiang, J., Wang, N. (2018) Control of citrus
huanglongbing via trunk injection of plant defense
activators and antibiotics. Phytopathol., 108: 186-195.
Huan, Y., Kong, Q., Mou, H., Yi, H. (2020) Antimicrobial
peptides: Classification, design, application and
research progress in multiple fields. Front. Microbiol.,
11: 582779.
Huang, C.Y., Araujo, K., Sánchez, J.N., Kund, G.,
Trumble, J., Roper, C., Godfrey, K.E., Jin, H. (2021) A
stable antimicrobial peptide with dual functions of
treating and preventing citrus huanglongbing. Proc.
Natl. Acad. Sci. U.S.A.,. 118: e2019628118.
Jumper, J., Evans, R., Pritzel, A., Green, T., Figurnov, M.,
Ronneberger, O., Tunyasuvunakool, K., Bates, R.,
Žídek, A., Potapenko, A., Bridgland, A., Meyer, C.,
Kohl, S.A.A., Ballard, A.J., Cowie, A., Romera-
Paredes, B., Nikolov, S., Jain, R., Adler, J., Back, T.,
Petersen, S., Reiman, D., Clancy, E., Zielinski, M.,
Steinegger, M., Pacholska, M., Berghammer, T.,
Bodenstein, S., Silver, D., Vinyals, O., Senior, A.W.,
Kavukcuoglu, K., Kohli, P., Hassabis, D. (2021) Highly
accurate protein structure prediction with AlphaFold.
Nature, 596: 583-589.
Ma, W., Pang, Z., Huang, X., Xu, J., Pandey, S.S., Li, J.,
Achor, D.S., Vasconcelos, F.N.C., Hendrich, C.,
Huang, Y., Wang, W., Lee, D., Stanton, D., Wang, N.
(2022) Citrus huanglongbing is a pathogen-triggered
immune disease that can be mitigated with antioxidants
and gibberellin. Nat. Commun., 13: 529.
Salse, J. (2016) Ancestors of Modern Plant Crops. Curr.
Opin. Plant Biol., 30: 134-42.
Xiaoke, F., Xiaojiao, H., Tao, C., Jing, Z., Yan, W., Qing,
C., Qingliang, L., Haoru, T., Xiaorong, W. (2017) A
new citrus rootstock 'Pujiang Xiangcheng' (Citrus
junos). J. Fruit Sci.,. 34: 917-920.
Xu, Q., Chen, L.L., Ruan, X., Chen, D., Zhu, A., Chen, C.,
Bertrand, D., Jiao, W.B., Hao, B.H., Lyon, M.P., Chen,
J., Gao, S., Xing, F., Lan, H., Chang, J.W., Ge, X., Lei,
Y., Hu, Q., Miao, Y., Wang, L., Xiao, S., Biswas, M.K.,
Zeng, W., Guo, F., Cao, H., Yang, X., Xu, X.W.,
Cheng, Y.J., Xu, J., Liu, J.H., Luo, O.J., Tang, Z., Guo,
W.W., Kuang, H., Zhang, H.Y., Roose, M.L.,
Nagarajan, N., Deng, X.X., Ruan, Y. (2013). The draft
genome of sweet orange (Citrus sinensis)
. Nat. Genet.,
45: 59-66.
ICBB 2022 - International Conference on Biotechnology and Biomedicine
334