Interleukin-4 Gene Polymorphisms in Type 2 Diabetes Mellitus in

Medan, Indonesia

Milahayati Daulay

, Mutiara Indah Sari

Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia

Department of Biochemistry, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia

Keywords: Interleukin-4 Gene, Polymorphisms, Diabetes Mellitus.

Abstract: Chronic hyperglycemia in type 2 diabetes mellitus is associated with the production of proinflammatory

cytokines such as Interleukin (IL)-1, Tumor Necrosis Factor (TNF), Interferon (IFN)-c, IL-6, IL-12, and IL-

18. This inflammatory condition triggers the formation of anti-inflammatory cytokines such as IL-4, IL-10,

IL-13, and IFN-α that work antagonistically against the pro-inflammatory cytokines. Interleukin-4 gene

polymorphisms are associated with inflammatory events arising from hyperglycemic conditions. This study

aims to determine the polymorphism of IL-4 -33 C>T gene in diabetic patients. A total of 40 diabetic patients

from Universitas Sumatera Utara Hospital, Medan were genotyped for IL-4 SNPs (single nucleotide

polymorphisms) -33 C>T using restriction fragment length polymorphism-polymerase chain reaction (RFLP-

PCR). Genotype frequencies were calculated in patients by direct gene counting. The most frequent genotype

in diabetic patients from Universitas Sumatera Utara Hospital in Medan was TT in 20 patients (50%). The

frequency of CT genotype was 18 (45%) and CC genotype was 2 (5%). Previous studies have shown

differences in genotype frequencies in other regions indicating a genetic factor difference in diabetes mellitus.

Based on the result of present study it may be concluded that the functional gene polymorphisms of IL-4 play

an important role in type 2 diabetes mellitus.

1 INTRODUCTION

Epidemiological studies have shown a tendency to

increase incidence rates and the prevalence of type 2

Diabetes Mellitus (DM) in different parts of the

world. The World Health Organization (WHO)

predicts an increase in the number of people with DM

who become one of the global health threats. In

Indonesia, WHO predicts an increase in the number

of people with DM from 8.4 million in 2000 to about

21.3 million by 2030. This report shows an increase

in the number of people with DM 2-3 times by 2035.

The International Diabetes Federation (IDF) predicts

an increase in the number of people with DM in

Indonesia from 9.1 million in 2014 to 14.1 million by

2035 (PERKENI, 2015).

According to the American Diabetes Association

(ADA) 2010, diabetes mellitus is a group of

metabolic diseases with characteristic hyperglycemia

that occurs because of abnormalities of insulin

secretion, insulin resistance or both. Chronic

hyperglycemia in DM is associated with the

production of proinflammatory cytokines and

inflammatory cytokines through Toll-Like Receptors

(TLRs) 2 and 4 activation resulting in destruction of

pancreatic beta cells and pancreatic endocrine

dysfunction in type 1 and 2 DM. This is characterized

by changes in proinflammatory cytokine levels such

as interleukin IL-1, Tumor Necrosis Factor (TNF),

Interferon (IFN) -c, IL-6, IL-12, and IL-18 in DM

patients (Frances, 2013). This inflammatory

condition triggers the formation of anti-inflammatory

cytokines such as IL-4, IL-10, IL-13, and IFN-α that

work antagonistically against the pro-inflammatory

cytokines (Voehringer, 2013)

Several studies have shown that there is an

association of IL-4 cytokine gene expression with

metabolic abnormalities of diabetes mellitus.

Interleukin-4 gene polymorphisms and changes in IL-

4 levels are associated with inflammatory events

arising from hyperglycemic conditions. (Tripathi,

2015) in his study showed the association of IL-4

genotypic polymorphism with type 2 DM in the

Indian population. Type 2 DM is known to be

associated with IL-4-590 C> T gene polymorphism

with increased CT variant in type 2 diabetes mellitus

Daulay, M. and Sari, M.

Interleukin-4 Gene Polymorphisms in Type 2 Diabetes Mellitus in Medan, Indonesia.

DOI: 10.5220/0010078905750577

In Proceedings of the International Conference of Science, Technology, Engineering, Environmental and Ramiﬁcation Researches (ICOSTEERR 2018) - Research in Industry 4.0, pages

575-577

ISBN: 978-989-758-449-7

575

compared with healthy control (Alsaid, 2013). (Li,

2013) found an association between IL-10- 1082 G /

A gene polymorphism with type 2 diabetes mellitus.

(Bid, 2008) also found an association between IL-4

and IL-1RN (VNTR) gene polymorphisms with the

incidence of type 2 diabetes mellitus. This study aims

to determine the polymorphism of IL-4 -33 C> T gene

in diabetic patients at Universitas Sumatera Utara

Hospital, Medan.

2 METHOD

The study was conducted in Universitas Sumatera

Utara Hospital and Integrated Laboratory of Medical

Faculty Universitas Sumatera Utara. To be eligible

for the study, patients had to give informed consent.

The study protocol was reviewed and approved by the

Research Ethical Committee Faculty of Medicine,

Universitas Sumatera Utara. All participants provided

written informed consent to participate in this study.

The type of this research is descriptive research

with cross sectional study approach with the number

of samples as much as 40 patients with type 2 diabetes

mellitus at Universitas Sumatera Utara Hospital,

Medan. Venous blood taken as much as 5 cc. DNA

isolation using kit from Promega. Examination of

interleukin-4 -33 C> T polymorphisms with PCR-

RFLP technique using BSmAI restrictive enzyme and

electrophoresis at 2% agarose. Primer F IL-4 -33 C>

T Primer F (forward)

CAAGTTACTGACAATCTGGTGT Primer R

(reverse) CGGCACATGCTAGCAGGAA with a

large PCR product of 223 bp. The genotype

frequencies are calculated directly.

3 RESULTS AND DISCUSSIONS

Table 1 shows the charateristics of respondents. Most

of the diabetic patients in Universitas Sumatera Utara

Hospital in Medan are male (52.5%) and more

common in the age between 40 -70 years as many as

33 patients (82.5%).

Table 1: Charateristics of respondents (n= 40).

Charateristics

Sex

Male

Female

52.5

47.5

Age

< 40

40-70

>70

2.5

82.5

Current study showed that type 2 diabetes mellitus

occurs most commonly in men. According to

(Ferguson, 2017), the high prevalence of diabetes in

men can be caused by several factors such as higher

visceral fat in males where visceral fat is associated

with high fat in the liver and pancreas. This risk

difference is influenced by the distribution of body

fat. In men, fat accumulation is concentrated around

the abdomen that triggers central obesity, which is

more at risk of triggering metabolic disorders. In

other words, men are more susceptible to diabetes

than women. In addition, hormonal factors also play

a role in high prevalence of diabetes in men. In this

study also found that diabetes mellitus type 2 is most

common in adults older than 40 years. The presence

of decreased function of organs due to aging causes

decreased work of the organ including the pancreas.

According to Indonesian Society of Endocrinologists,

age over 40 years is one of the risk factors for the

occurrence of type 2 diabetes mellitus (PERKENI,

2015).

Table 2: Distribution of frequency of genotypes.

Genotypes

n (%)

2 (5)

(45)

(50)

Analysis of the polymorphisms at -33 C>T of IL-

4 by BSmAI restriction enzyme showed that the

frequency of the TT genotype was 20 (50%) . The

frequency of CT genotype was 18 (45%) and CC

genotype was 2 (5%).

Figure 1: RFLP-PCR product of IL-4 gene -33 C>T.

Mechanisms of various diseases such as infection,

autoimmune, malignant disease are affected by the

production of proinflammatory and antiinflammatory

cytokines (Bidwell, 1999). The difference in gene

expression brought by differences in gene sequence

ICOSTEERR 2018 - International Conference of Science, Technology, Engineering, Environmental and Ramiﬁcation Researches

576

concludes how the mechanism and development of a

disease (Sari and Sari, 2017). The presence of

different cytokine profiles among individuals

indicates the presence of gene polymorphisms that

produce these cytokines. This study showed

polymorphism of IL-4 -33 C>T gene in diabetic

patients where the TT genotype has the largest

frequency among people with type 2 diabetes mellitus

in Medan, North Sumatera, Indonesia. This is in

contrast to the results obtained by (Alsaid, 2013) in

Egypt, where in the type 2 diabetes mellitus patients,

most genotypes were CT and in Pakistan by (Micheal,

2013), the highest genotypes were CC in patients with

asthma and allergic rhinitis. Meanwhile, in Iran, by

(Arababadi, 2010) found the most genotype is CC in

patients with type 2 diabetes mellitus. This indicates

that the interleukin-4 gene polymorphisms have an

effect on the occurrence of diabetes mellitus.

4 CONCLUSIONS

In this study, we found the presence of interleukin-4

gene polymorphism in type 2 diabetes mellitus in

Medan, North Sumatera, Indonesia. The functional

gene polymorphisms of interleukin-4 play an

important role in type 2 diabetes mellitus. Further

research is needed to compare interleukin-4 gene

polymorphisms with the control group.

ACKNOWLEDGEMENTS

Authors are grateful to the Ministry of Research and

Technology and Higher Education of Republic

Indonesia. This work was supported by research

grants from TALENTA USU 2018 contract number

2590/UN5.1.R/PPM/2018 date 16 March 2018.

REFERENCES

Alsaid, A., El-Missiry, M., Hatata, E., Tarabay, M., Settin.,

M. 2013. Association of IL-4-590 C>T and IL-13-1112

C>T Gene Polymorphisms with the Susceptibility to

Type 2 Diabetes Melitus. Disease Markers, 35(4), 243-

247

American Diabetes Association (ADA). 2010, Diagnosis

and Classification of Diabetes Melitus. Diabetes Care,

37(1), 81–90

Arababadi, M. K. , 2010. Interleukin-4 gene

polymorphisms in type 2 diabetic patients with

nephropathy. Iranian Journal of Kidney Diseases, 4(4),

302-306

Bid, H. K., Konwar, R., Agrawal, C. G., Banerjee, M. 2008.

Association of IL-4 and IL-1RN (receptor antagonist)

gene variants and the risk of type 2 diabetes mellitus: a

study in the north Indian population. Indian J Med Sci.,

62(7), 259-266

Bidwell, J., Keen, L., Gallagher, G., Kimberly, R.,

Huizinga, T., McDermott, M. F., Oksenberg, J.,

McNicholl, J., Pociot, F., Hardt, C., Alfonso, S. D.

1999. Cytokine gene polymorphism in human disease:

on-line databases. Genes and Immunity, 1, 3–19

Francés, D. E., Ingaramo, P.I., Ronco, M. T., Carnovale, C.

E. 2013. Diabetes, an inflammatory process: Oxidative

Stress and TNF-alpha involved in hepatic complication.

J. Biomedical Science and Engineering, 6, 645-653

Ferguson, L. D., Celis-Morales, C., Ntuk, U. E., Mackay,

D. F., Pell, J. P., Gill, J. M. R., Satta, N. 2017. Men

across a range of ethnicities have a higher prevalence of

diabetes: findings from a cross-sectional study of

500000 UK Biobank participants. Diabetes Medicine,

1-16

Li, J., Wu, S., Ming-Rui, W., Ting-Ting, W., Ji-Min, Z.

2013. Association of the interleukin-10 − 592A/C, −

1082G/A and − 819T/C gene polymorphisms with type

2 diabetes: A meta-analysis. Gene, (5)21, 211-216

Micheal, S., Minhas, K., Ishaque, M., Ahmed, F., Ahmed,

A. 2013. IL-4 Gene Polymorphisms and Their

Association With Atopic Asthma and Allergic Rhinitis

in Pakistani Patients. J Investig Allergol Clin Immunol,

23(2), 107-111

Perkumpulan Endokrinologi Indonesia (PERKENI). 2015,

Pengelolaan dan Pencegahan Diabetes Melitus Tipe 2

di Indonesia. PB. PERKENI. Jakarta, 5

edition

Sari, M. I., Sari, D. I. 2017. Nutrient Intake Apolipoprotein

A5 -1131T>C Polymorphism and Its Relationship with

Obesity. IOP Conference Series: Materials Science and

Engineering.180. 012094

Tripathi, A. K., Smriti, S., Jitendra, K. T., Rishabh, D. S.,

Srikant, K., Pranav, M., Ugam, K. C., Manoj, I. 2015.

Association of Genetic Polymorphism of Inflammatory

Genes (IL-1β and IL-4) with Diabetes Type 2. Journal

of Genetic, Molecular and Cellular Biology, 2(1), 1-9

Voehringer, D., Reese, T. A., Huang, X., Shinkai, K.,

Locksley, R. M. 2006. Type 2 immunity is controlled

by IL-4/IL-13 expression in hematopoietic non-

eosinophil cells of the innate immune system. Journal

of Experimental Medicine, 203(6) 1435–1446

Interleukin-4 Gene Polymorphisms in Type 2 Diabetes Mellitus in Medan, Indonesia

577