The Association between Tuberculosis Cytology through Eosinophilic

Mass with Dark Brown Particles against Various Bacterial Strains

Delyuzar

, Bintang Yinke Magdalena Sinaga

, and Rina Yunita

Departement of Anatomycal Pathology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia.

Departement of Pulmonology,Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia.

Departement of Mirobiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia

Keywords: Tuberculosis, cytology, eosinophilic mass.

Abstract: Diagnosis of tuberculosis cytology through eosinophilic mass with dark brown particles has been shown to

establish the diagnosis of tuberculous lymphadenitis. The eosinophilic mass with dark brown particles is not

a classic histopathological of tuberculosis infection, there are allegations that this picture is related to a

decrease in the patient's immune system. Many HIV TB patients do not provide a classic TB picture on

pathology examination. Mycobacterium avium is associated with TB infection in HIV AIDS patients. The

ability to accurately detect tuberculosis infection is very important in line with USU's research strategic plan

with the specialty in the field of Tropical Science and Medicine in controlling tuberculosis infection,

especially in patients with reduced immune system. Fine needle biopsy was performed twice for cytologic

and Polymerase Chain Reaction (PCR) examination. Statistical analysis was done using Pearson’s Chi

square test. Out of 194 cases, 50% were suspicious for tuberculous lymphadenitis and 51% were proved to

be positive M. tuberculosis. Ther was also a trend association between eosinophilic mass and M. avium. All

suspected cases of tuberculous lymphadenitis showed eosinophilic mass on microscopic examination of

FNA cytology. Our findings suggest the potential of eosinophilic mass as a new diagnostic criteria for TB.

This can be the basis of further research on eosinophilic mass.

1 INTRODUCTIONS

Tuberculosis (TB) is still an Indonesian major

problem. Indonesia is the second country in the

world to have the most cases(321,308 total cases

from 242 million inhabitants, 2011). As the fourth

country in the cause of the death TB also ranks in

Indonesia. Therefore, it needs to research more

deeply both for diagnostics and therapy (WHO,

2016). An increase in human resources is needed,

include ability of the health workers to find cases

and overcome them to decrease tuberculosis

transmissions (Delyuzar, 2006). A fast way to detect

M. tuberculosis infection will help accelerate early

diagnosis in patients who are clinically suspected

tuberculosis patients and immediately followed by

appropriate management (Lalvani, 2001).

Lymphadenitis TB (LTB) can be performed

cytology through fine needle aspiration biopsy

(FNAB). Diagnostic criteria that have been used to

diagnose tuberculosis cytologically are found

epithelioid type histiocyte cells and cells with

multiple nuclei of the Langhans type (Ammari,

2003). Sarwar A. (2004) explained that in addition

to the Langhans cell (multinuclear giant cell) also

contains caseous necrosis. PurohitManju (2007)

using PCR as the gold standard received anti-

MPT64 immunohistochemistry techniques in TB in

the abdomen and lymph nodes of sensitivity,

specificity, positive predictive value and negative

predictive values were 92%, 97%, 98%, and 85%.

Immunistochemistry with anti-MPT64 antiserum

can be done relatively quickly, sensitively, and

specifically to establish a diagnosis of TB (Tubbs

2009). To establish a diagnosis of tuberculosis

lymphadenitis can also be done culture, smear with

ZiehlNeelsen staining in addition to

histopathological features both classical and

immunohistochemistry (Robbins, 2003).

This study uses gold standard biomolecular

examination of PCR, so that it complements each

other to assess the accuracy of fine needle biopsy

cytology diagnostics on unusual TB features

852

Delyuzar, ., Sinaga, B. and Yunita, R.

The Association between Tuberculosis Cytology through Eosinophilic Mass with Dark Brown Particles against Various Bacterial Strains.

DOI: 10.5220/0010094708520855

In Proceedings of the International Conference of Science, Technology, Engineering, Environmental and Ramiﬁcation Researches (ICOSTEERR 2018) - Research in Industry 4.0, pages

852-855

ISBN: 978-989-758-449-7

(eosinophilic mass with dark brown particles), as a

new criteria of cytology picture of tuberculosis.

2 OBJECTIVES

The aimed of this study is to analyze the association

between eosinophilic mass and M. tuberculosis.

3 METHODS

This cross-sectional study was carried out in RSUP

HAM Medan/Department of Anatomical Pathology,

Faculty of Medicine USU Medan or who came to

Anatomical Pathology Department, while the

examination according to WHO recommendations,

PCR was conducted at the USU Integrated

Laboratory. The research was done after getting

permission from Ethical Committee of Medical

Faculty USU Medan. Specimen from FNA was done

using a 23 gauge needle, 10 ml syringe and pistol

(Comeco, Sweden). Aspirate was directly smeared

and stained with May-GrunwaldGiemsa stain.

Second FNA procedure was performed to obtain

aspirate for PCR examination.

PCR was used to confirm the presence of M.

tuberculosis and prove the cytological diagnosis of

the first FNA procedure. The

followingmycobacterial and nonmycobacterial

reference bacterial strains were obtained from the

American Type Culture Collection (ATCC;

Rockville, Md.) used in PCR amplification and

grown according to the instructions of ATCC: M.

tuberculosis and M. avium. M. tuberculosis Primers,

A pair of 24-base synthetic oligonucleotides that

bracket a 165-base region of a gene codes for a 65-

kilodalton antigen was synthesized. The sequences

of the oligonucleotide primers were (from the 5' to

the 3' ends) CTAG

GTCGGGACGGTGAGGCCAGG and

CATTGCGAAGT GATTCCTCCGGAT. Another

oligonucleotide of 40 bases in length located

between the two primers was synthesized to be used

as an internal probe, and its sequence was (from the

5' to the3' ends) M. avium Primers, a 427-base

region.

Statistical analysis was carried out using SPSS

22 version (SPSS Inc., Chicago) with a 95%

confidence interval. Pearson’s Chi square test with

significance p<0.05 was applied to assess the

association between eosinophilic amorphous mass

and tuberculous.

4 RESULTS

Out of the total 194 patients with lumps on the neck,

18.6% of cases was clinically diagnosed as abscess,

31.4% as non-specific lymphadenitis, 50% as

suspicuous for tuberculous lymphadenitis (Table 1).

Table 1: Baseline characteristics of the samples

Characteristics Clinical dia

nosis Number

(

)

Abscess 36 (18.6%)

Non-specific lymphadenitis 61 (31.4%)

Suspicious for tuberculous

hadenitis

97 (50%)

Table 2: Association of eosinofilic mass with M.

tuberculosis PCR results.

PCR

Eosino

hilic mass

Presence Absence

M.TB (+) 94 1

M. TB (-) 3 96

Table 3: Association of eosinofilic mass with M. avium

PCR results.

PCR Eosinophilic mass

Presence Absence

M. avium

(

)

61 2

M. avium

(

)

36 95

There was a significant association between

eosinophilic mass with M. Tuberculosis p value <

0.001 (Table 2).There was also a trend association

between eosinophilic mass with M. avium (Table 3).

Tuberculosis infection proved positive through

PCR in 51% of cases (Figure 1).All suspected cases

of tuberculous lymphadenitis showed eosinophilic

mass on microscopic examination of FNA cytology

(Figure 2).

Figure 1: 165 base pairs indicates the presence of M.

tuberculosis and 427 base pairs indicates the presence of

M. avium on PCR

427bp

165bp

The Association between Tuberculosis Cytology through Eosinophilic Mass with Dark Brown Particles against Various Bacterial Strains

853

Figure 2: Eosinophilic mass in cytologic specimen

DISCUSSIONS

Patel study (2016), 50% of the samples were non-

specific lymphadenitis, thirty-six percent was TB

and ten percent was abscess, whereas in this study

194 cases (50%) of eosinophilic mass were

suspected of Tuberculosis. As control, 31,44% were

non-specific lymphadenitis and 18,56% abscess.

PCR examination, as gold standard, found 95

positive samples of M. tuberculosis and 99 negative

M. tuberculosis samples.

Microscopically the typical picture tissue of the

mycobacterium tuberculosis lesion is granuloma or

caseous necrosis. Granulomas are a collection of

macrophages (macrophages). Macrophages also

called histiocytes can fuse to form multinucleated

giant cells, magrophages in granulomas are often

called ephiteloid. Epitheloid macrofages are

different from magrophages, usually because they

have an elongated core similar to a shoe sole, the

core is larger and the cytoplasm is more pink, this

change occurs because the magrophage is activated

by the antigen. Granulomas may be accompanied by

other components including lymphocytes,

neutrophils, eosinophils, multinucleted giant cells

and fibroblasts. Actually granulomas are not only

caused by m.tuberculosis but also due to leprosy,

histoplasmosis, cryptococcosis, coccidioidomycosis,

and blastomycosis. Non-infectious granulomas can

be found in sarcoidosis, Crohn's disiase, berylliosis,

Wagener's granulomatosis, Churg-Staruss syndroma

and others. Cytology features that contain many

macrophages are the most common reactive,

infectious and sarcoidosis processes, other

conditions can occur in carcinoma with post

obstructive pneumonia, infarct and should be

differentiated also with Langerhan cell histocytosis

(Renshaw, 2005).

Granulomas in tuberculosis tend to form necrosis

(caseatingtubercule) although there is no form of

necrosis, accompanied by multinucleated giant cells

with a nucleus on the edge on one side to form

horseshoe/Langhans giant cell (Underwood, 2009).

Krisnan (2001) reported different cytologic features

in HIV patients he called negative images with a

negative rod shape and blue black ground, with no

classic features found in LTB patients.

Lubis (2008) found structures of eosinophilic

mass with dark brown particles cytologically in

patients clinically untreated with TB treatment.

Lisdine's research, et al (2003) using Kudoch's

reaction to obtain a spotted eosinophilic fine

granular necrotic mass can be used as a basis for

diagnosing extrapulmonary tuberculosis with

probability values of 97%, 91% specificity and 94%

accuracy. From the results of this study means the

patches found in the pussy microscopically have

meaning meaning, where if the encounter of these

spots means that the cause of the lesion tuberculosis

germs, while not encountered these spots are not the

cause of tuberculosis.

Eliandy (2010) examined the appearance of

antigens using rabbit polyclonal to Mycobacterium

tuberculosis antibody (ab905), Abcam. The

appearance of Mycobacterium tuberculosis was seen

in 14 cases with small oval-shaped bodies within

macrophages, 21 cases with dark patches, 1 case

with non-specific chronic inflammation, and 7 cases

with abscesses. Lubis et al (2010), examined the

difference in the number of positive IHC displays in

lesions with small oval-shaped bodies in

macrophages and nonspecific chronic inflammation,

and there was a difference in the proportion of

positive IHC displays in lesions with dark patches of

mass amorphous granular eosinophilic ears and

abscesses (

Sarwar A et al. 2004).

But there are still

pros and cons about the use of

Immunocytochemistry in this cytology so it needs to

be reinforced with other techniques more accurate,

researchers use the PCR technique as a gold

standard. Raviglione and O'Brien (2010) mentioned

that granuloma features are not usually found in

HIV-infected patients, whereas granulomas are

characteristic of TB lesions.

6 CONCLUSIONS

There was an associate between eosinophilic mass

and M. tuberculosis. It indicates the possibility of

this cytologic features as a new diagnostic criteria

for tuberculous infection. There was also a trend

association between eosinophilic mass and M.

avium. It indicates the possibility of this cytologic

features for Mycobacteriumtuberculosis and

Mycobacterium nontuberculosis infection.

ICOSTEERR 2018 - International Conference of Science, Technology, Engineering, Environmental and Ramiﬁcation Researches

854

ACKNOWLEDGEMENTS

This study was supported by the Ministry of

Research, Technology, and Higher Education

Republic of Indonesia, Universitas Sumatera Utara,

Research Institution, Number:

27/UN5.2.3.1/PPM/KP-DRPM/2018.

REFERENCES

Ammari FF, Bani Hani AH, Ghariebeh KI., 2003.

Tuberculosis of thelymph glands of the neck: a limited

role for surgery. Otolaryngol Head and Neck Surg,

128 (4): 576-580.

Delyuzar, Arbaningsih SR, Ruswardi., 2006.

Empowerment human resources against tuberculosis

in North Sumatera: a FIDELIS initiativeThe

International Jornal of Tuberculosis and Lung Disease,

10 (11).

Eliandy S, Lubis HMND, Delyuzar., 2011.

HubunganGambaranBercak-bercakGelap (Dark

Specks) padaLatarBelakang Material Nekrotik

Granular Eosinofilikdengan Kadar CD4

Penderitadengan Kadar CD4

PenderitaLimfadenitisTuberkulosisServikalis yang

Disertai HIV/AIDS.Tesis Program DokterSpesialis.

Available from: http://repository.usu.ac.id/

handle/123456789/26585.

Krisnan R, Iyengar, Basu, Debdatta, 2001. Negative

Immages in the Fine Neddle Aspiration Cytologic

Diagnosis of Mycobacterial Infections. Malaysian

J.Pathol . 23 (2): 89-92.

Lalvani A et al. 2001. Rapid detection of Mycobacterium

tuberculosis infection by enumerationof antigen-

spesific T cells.Am J respirCrit Care med; 163: 824-

828.

Lisdine, Lubis HMND. Massa Nekrotik Bergranul Halus

Eosinofilik Berbercak-bercak sebagai Pembeda Abses

Tuberkulosa dan Abses non Tuberkulosa. Available

from:http://repository.usu.ac.id/bitstream/123456789/6

302/1/patologi-lisdine.pdf.

Lubis HMND, Lubis HML, Lisdine, Hastuti NW, 2008.

Dark specks and eosinophilic granular necrotic

material as differentiating factors between tuberculous

and nontubercolousabcesses. Indonesian Journal of

Pathology; 17 (2): 49-52.

Patel VK, Sheth R, Shah K, 2016. A retrospective study

on role of fine needle aspiration cytology in diagnosis

of cervical lymphadenopathy. International Journal of

Medical Science and Public Health; 5 (8): 1588-1591.

Purohit MR, Mustafa T, Wiker HG, Morkve O., 2007.

Immunohistochemical diagnosis of abdominal and

lymph node tuberculosis by detectingMycobacterium

tuberculosis complex specific antigen

MPT64.DiagnPathol. 2: 36.

Raviglione, Mario C, O’Brien RJ., 2010. Tuberculosis in:

Harrison’s Infectious Diseases. Editor: Dennis L.

Kasper, Anthony S. Fauci. McGraw Hill Companies.

:596-617.

Renshaw, Andrew., 2005. Macrophage rich pattern In:

Aspiration Cytology A Pattern Recognition Approach,

Elsevier Saunders: 47-48.

Robbins SL and Cotran RS., 2003. Tuberculosis in:

Pathologic Basis of Disease. Seventh edition. New

York.

Sarwar A et al., 2004. Spectrum of Morphological

Changes in TuberculousLimfadenitis. International

Journal of Pathology, 2: 85-89.

Tubbs, Raymond R, Stoler, Mark H., 2009. Molecular

Diagnosis of Infectious Agents in Tissue. Cell and

Tissue Based Molecular Pathology. Churchill

Livingstone Elsevier: 182-193.

Underwood, JCE., 2009. Cross SS. Inflamation In:

General and Systemic Pathology, Fifth Edition,

Churchill Livingstone Elsevier: 200-219.

WHO., 2016. Global Tuberculosis Report: 32.

The Association between Tuberculosis Cytology through Eosinophilic Mass with Dark Brown Particles against Various Bacterial Strains

855