The Peak of Cytochrome-c (Cyt-c) Gene Expression in Inflammatory

Stage after Amputation of Digit Tip Mice (Mus musculus)

Titta Novianti

, Febriana Dwi Wahyuni

, It Jamilah

and Syafruddin Ilyas

Department of Biotechnology, Universitas Esa Unggul, Jl. Raya Arjuna Utara No. 9, Jakarta Barat, Indonesia

Department of Biology, Universitas Sumatera Utara, Medan, Indonesia

Keywords: Cytochrome-c (Cyt-c), Apoptosis, Mitochondria, Tissue Regeneration.

Abstract: The complexity of the tissue regeneration process requires the activity of cells and energy. The energy

obtained from cellular respiration processes. The cellular respiration involves the enzyme has a role transfer

an electron. Cytochrome-c (Cyt-c) is an enzyme in the mitochondria inner membrane that has a role in cell

respiration and stimulates apoptosis cells. We studied the Cyt-c gene expression in inflammatory phase of

tissue regeneration of digit tip mice (Mus musculus) after amputation to analyze a role in tissue regeneration.

The result of the Cyt-c gene expression reached a peak on day 3. It showed that the tissue regeneration process

needs high energy and involves cell apoptosis to stimulate regeneration. The result of ANOVA homogeneity

test of Cyt-c gene expression differentt significantly for each growth day (p <0.05).

1 INTRODUCTION

The tissue regeneration process involves the forming

of new cells and tissue. The damaged cells will

undergo a process of apoptosis that the programmed

of cell death (Gauron et al., 2013). Apoptosis cell is

interested in the tissue regeneration process because

it is related to the formation of new cells. The

macrophages will be phagocytosed into the dead cells

and stimulate extracellular matrix formation that

plays a role in tissue regeneration (Reinke & Sorg,

2012).

The higher the apoptotic cell process occurs, the

higher the extracellular matrix produced (Calve &

Simon, n.d.). An apoptosis, cell process involving the

enzymes and proteins, one of which is cytochrome c

(Allen, 2011). This enzyme has a role in electron

transfer from system III to system IV in mitochondria

inner membrane and a role in cell apoptosis. The Cyt-

c biogenesis process will increase the Cyt-c enzyme

in cell apoptosis. A Cyt-c biogenesis process is a

multiplication of the Cyt-c enzyme (Panigrahy et al.,

2013).

The process of tissue regeneration occurs in four

phases, the wound-healing, the blastema, the

regeneration phase, and the materials phase (Krafts,

2010). The tissue was dominated by the white blood

cells in the wound-healing phase. The macrophage

phagocytes the antigen and phagocytes the apoptotic

cells in the wound-healing phase. The wound-healing

phase occurs in the first days after injury (Mescher,

2017).

In this study, we will analyze the Cyt-c gene

expression in tissue regeneration of digit tip mice

post-amputation. The study result to be the initial

research for further analysis stimulates the

regeneration process in organisms that have limited

ability in tissue regeneration.

2 MATERIAL AND METHOD

2.1 Sample

The research ethics code for this study proposed by

the Research Ethics Commission Esa Unggul

University. The research sample was thirty male mice

(Mus musculus) for Swiss Webster that eight weeks

old and weighing twenty grams. The number of

samples is adopted by the Federer formula. We got

the mice from the research and development

laboratory, the Ministry of Health of the Republic of

Indonesia. The sample was maintained and treated by

the laboratory assistant from the Health Ministry of

the Republic of Indonesia. Mice were anesthetized by

ketamine/xylazine at a dose of 0.5 gr/kg BW and

Novianti, T., Wahyuni, F., Jamilah, I. and Ilyas, S.

The Peak of Cytochrome-c (Cyt-c) Gene Expression in Inﬂammatory Stage after Amputation of Digit Tip Mice (Mus musculus).

DOI: 10.5220/0009566300780082

In Proceedings of the 1st International Conference on Health (ICOH 2019), pages 78-82

ISBN: 978-989-758-454-1

amputated on the 3rd phalanges of digit tip mice. The

tissue growth on day 0 (4 hours after amputation), day

1, day 3, and day 5 after the amputation was collected

to analyze the sample for gene expression and

histological analysis.

2.2 Histology Preparation

Histology preparations stained with hematoxylin-

eosin (HE) strokes and histochemical: 10% formalin;

70% alcohol; 80% alcohol; 95 % alcohol; and 100%

alcohol; xylol; paraffin block; hematoxylin-eosin;

equates; the outward appearance of Van Gieson.

Software ImageJ I-46 has various features to

analysis the semi-quantitative of the histological

sample of HE staining. Image J software can use to

calculate the number of cells and measure the length

or area of cells and tissues. Image J software can be

downloaded for free and used offline.

The length calculation is done by opening the

histology image file first and setting the image scale

using the scale set feature. The length calculation

used in the line drawing feature is got automatically

by using the measure feature.

2.3 Analysis of Gene Expression

The primary DNA of the Cyt gene and the 18S gene,

as a reference gene, were amplified by qPCR

procedure. Desain primer Cyt-c gene Forward

ATTCCTTCATGTCGGACGAG and Reverse

ACTGAGAAGCCCCCTCAAAT.

The qPCR method amplification DNA through

the stages is DNA synthesis, reverse transcriptase,

amplification with 40 cycles at an annealing

temperature of 55

C. Finally, the stage is the melting

curve stage. Negative controls operated by free water

as a substitute for RNA to get the incorrect positive

results. The results of qRT-PCR obtained the value of

efficiency and Cycle Threshold (CT) of DNA

amplification. Analysis of gene expression assessed

by relative qualification by the value of mRNA

expression quantification relatively by the Livak

method.

2.4 Statistical Analysis

Statistical analysis of the normality test used the

Kolmogorov Smirnov test. The data distributed not

normally, so analytical analysis using a non-

parametric test. The homogeneity test performed

using the ANOVA test and the correlation test by the

Spearman test.

3 RESULTS

3.1 The Growth of Digit Tip Mice

(Mus musculus)

After amputation, the digit tip mice grow to replace

the lost tissue (figure 1). On day 0 and day 1, therein

common is no visible growth of tissue. We suspected

that it is the inflammatory tissue. From day 3 to day

5, the tissue appeared to grow faster in the wound

area. We suspect that the cell was more actively

dividing. Growing tissue remains the collecting

dividing cells that form the new tissue.

Figure 1: Growth of digit tip mice (Mus musculus) from day

0 to day 5 after amputation (A) Digit tip on day 0 (4 hours

after amputation) (B) 1 day after amputation (C) 3 day after

amputation (D) 5 day after amputation.

The growth curve of the digit tip mice after

amputation shown in fig 2. The growth curve grows

faster, significantly from day 0 (4 hours after

amputation) until day 5 after amputation. The growth

indicates that some cells divided actively.

Figure 2: Growth curve of a digit tip mice (Mus musculus)

from day 0 (4 hours after amputation) until day 5. Curve

lines increase rapidly from day 0 to day 5.

0 1 3 5

lengt of digit tip (mm)

growth day

The Peak of Cytochrome-c (Cyt-c) Gene Expression in Inﬂammatory Stage after Amputation of Digit Tip Mice (Mus musculus)

3.2 The Result of Histology Staining

The histological analysis of digit tip mice (Mus

musculus) shows the intense activity of cells in Figure

3. On day 0 (4 hours after amputation) and day 1, the

wound area tissue dominated by white blood cells. In

some of the wound area, there are red blood cells. On

day 5, stem cells divided and differentiated to form

the new tissue.

Figure 3: The Tissue histology of digit tip mice (Mus

musculus) (A) Tissue digit tip mice on day 0 shows the

presence of red blood cells (single arrow) that spread in the

tissue due to injury when amputation (B) day 1, white blood

cells that have many cell nuclei (single arrow) spread in the

area wound (C) osteoblast cells (single arrow) that are

actively dividing, fibroblasts like cells appear to start

spreading in fat tissue (D) cells like fibroblasts (single

arrows) division results begin to increase, the appearance of

new blood vessels (double arrows) (enlargement 400 x).

3.3 mRNA Gene Expression

Figure 4: Cyt gene mRNA expression relative to control.

The results of gene expression quantitative relatively

than controls produce diverse gene expression at each

stage of tissue regeneration (Figure 3). In the

inflammatory phase, the Cyt gene expression relatively

higher than controls. Cyt gene expression increased

and reached a peak on day 3 after amputation.

3.4 Statistical Analysis

3.4.1 Homogeneity Test

Homogeneity test results on the length of the digit tip

of mice on each growth day showed a significant

difference in tissue growth (p < 0.05) using the

ANOVA test. There was no difference in the growth

of digit tip tissue growth between day 0 to day 5. The

difference in the expression of the Cyt gene mRNA

was significantly different (p < 0.05) with the

ANOVA test.

Figure 5: Significantly different ANOVA homogeneity test

(p < 0.05) (A) there is no different growth of digit tip mice

(Mus musculus) from day 0 until day 5 (B) Cyt gene mRNA

expression that is different between day 0 and day 1,

between day 1 and day 3, between day 3 and day 5.

3.4.2 Correlation Test

Spearman correlation test results indicated there is no

correlation between the expression of Cyt gene

mRNA and the length of tip mice digit growth.

Spearman correlation test results showed p > 0.05.

Figure 6: Spearman's correlation test between the growth

length of digit tip mice with the mRNA expression of the

Cyt gene (p > 0.05).

0,00

10,00

20,00

30,00

40,00

0 1 3 5

mRNA expression relatively

than control

growth day

Cyt-c Control

ICOH 2019 - 1st International Conference on Health

4 DISCUSSION

The growth of the digit tip mice (Mus musculus)

tissue indicates a relatively rapid growth in the

inflammatory phase. The results of the histological

analysis showed the proliferation and differentiation

of cell activity. White blood and fibroblast-like cells

appear on day 5 Increaser than day 1. According to

Mechner, in inflammation phase occurs the process

of cleansing the tissue in the wound area from

bacterial infection and cells undergoing apoptosis by

white blood cells (Mescher, 2017).

This activity of cells requires high energy that it

will trigger cellular respiration in mitochondria to

produce energy (ATP) (Duguez, Féasson, Denis, &

Freyssenet, 2002). Cytochrome-c (Cyt-c) is a protein

in the inner membrane of mitochondria that play a

role in capturing electrons in the respiration chain and

acts as a deterrent and inhibits oxidative stress (Allen,

2011). The activity of cells requires high energy that

will trigger cellular respiration in mitochondria to

produce energy like ATP (Pelicano et al., 2003).

Cytochrome-c (Cyt-c) protein is in the inner

membrane mitochondria has a role in capturing of

electrons, acting as a deterrent, and inhibiting

oxidative stress. The other role of Cyt-c enzyme, it

acts as an agent in the process of cell apoptosis (Allen,

2011); (Wright et al., 2007). The BCL-2 protein gives

the signal to Cyt-c and stimulates the caspase enzyme

in the process of apoptosis occurs (Allen, 2011).

In tissue regeneration of digit tip mice, the

expression of Cyt-c gene is relatively high and

reaches its peak in the inflammatory phase. We

suspect that this expression is thought to be due to the

role of Cyt-c in cellular respiration and the process of

cell apoptosis.

Awarding to Osuma, there was an increase in

energy demand that increased during the tissue

regeneration process (Osuma, Riggs, Gibb, & Hill,

2018). The analysis of Cyt-c gene expression

demonstrated that an increase in gene expression in

the inflammatory phase accompanied by an increase

in cell differentiation and proliferation. It's suspected

that in this phase there was an increase in energy

demands and increasing cell apoptosis process.

Awarding to Bergmann and Steller, the process of cell

apoptosis will stimulate the proliferation and

differentiation of stem cells and progenitor cells in

tissues (Akhmetshina et al., 2012). The histological

analysis of digit tip mice tissue regeneration showed

an increase in cell proliferation and differentiation

after the severe of the Cyt-c gene expression. In the

tissue, there is a proliferation of basal lamina cells,

white blood cells, fibroblast-like cell cells, and the

cells of dermis tissue. Activation of proliferation and

differentiation of progenitor cells in the inflammatory

phase produces the new blood cells and the layer of

epidermis and dermis so that the wound area begins

to cover.

The study results can be used as a reference for

the next study about the stimulation of adult tissue

regeneration that has limited ability in tissue

regeneration. To stimulate adult tissue regeneration,

we must try stimulating the expression of genes that

play a role in overcoming inflammation, genes that

play a role in providing energy, and genes that play a

role in the process of proliferation, differentiation,

cell migration, and tissue morphogenesis.

5 CONCLUSIONS

Cyt-c gene expression occurs in the inflammatory

phase that stimulates the activity of cell proliferation

and differentiation.

ACKNOWLEDGMENT

Thank you to the Ministry of Higher Education and

Higher Education for the PKPT Scholarship Research

Grant for the next two years (2019-2020). Thank you

to Esa Unggul University for supporting both morally

and materially for doing this research as well.

REFERENCES

Akhmetshina, A., Palumbo, K., Dees, C., Bergmann, C.,

Venalis, P., Zerr, P., … Distler, J. H. W. (2012).

Activation of canonical Wnt signalling is required for

TGF-β-mediated fibrosis. Nature Communications, 3.

https://doi.org/10.1038/ncomms1734

Allen, J. W. A. (2011). Cytochrome c biogenesis in

mitochondria - Systems III and v. FEBS Journal,

278(22), 4198–4216. https://doi.org/10.1111/j.1742-

4658.2011.08231.x

Calve, S., & Simon, H. (n.d.). Biochemical and mechanical

environment cooperatively regulate skeletal muscle

regeneration. https://doi.org/10.1096/fj.11-200162

Duguez, S., Féasson, L., Denis, C., & Freyssenet, D. (20

02). Mitochondrial biogenesis during skeletal muscle

regeneration. American Journal of Physiology.

Endocrinology and Metabolism, 282(4), E802–E809.

https://doi.org/10.1152/ajpendo.00343.2001

Gauron, C., Rampon, C., Bouzaffour, M., Ipendey, E.,

Teillon, J., Volovitch, M., & Vriz, S. (2013). Sustained

production of ROS triggers compensatory proliferation

The Peak of Cytochrome-c (Cyt-c) Gene Expression in Inﬂammatory Stage after Amputation of Digit Tip Mice (Mus musculus)

and is required for regeneration to proceed. Scientific

Reports, 3, 1–9. https://doi.org/10.1038/srep02084

Krafts, K. P. (2010). The hidden drama Tissue repair.

Organogenesis, 6(4), 225–233. https://doi.org/10.4161/

org6.4.12555

Mescher, A. L. (2017). Macrophages and fibroblasts during

inflammation and tissue repair in models of organ

regeneration, (March), 39–53. https://doi.org/10.1002/

reg2.77

Osuma, E. A., Riggs, D. W., Gibb, A. A., & Hill, B. G.

(2018). High throughput measurement of metabolism in

planarians reveals activation of glycolysis during

regeneration. Regeneration, (August), 1–9.

https://doi.org/10.1002/reg2.95

Panigrahy, D., Kalish, B. T., Huang, S., Bielenberg, D. R.,

Le, H. D., Yang, J., … Kieran, M. W. (2013).

Epoxyeicosanoids promote organ and tissue

regeneration. Proceedings of the National Academy of

Sciences, 110(33), 13528–13533. https://doi.org/10.

1073/pnas.1311565110

Pelicano, H., Feng, L., Zhou, Y., Carew, J. S., Hileman, E.

O., Plunkett, W., … Huang, P. (2003). Inhibition of

Mitochondrial Respiration. Journal of Biological

Chemistry, 278(39), 37832–37839. https://doi.org/10.

1074/jbc.M301546200

Reinke, J. M., & Sorg, H. (2012). Wound repair and

regeneration. European Surgical Research, 49(1), 35–

43. https://doi.org/10.1159/000339613

Wright, D. C., Han, D. H., Garcia-Roves, P. M., Geiger, P.

C., Jones, T. E., & Holloszy, J. O. (2007). Exercise-

induced mitochondrial biogenesis begins before the

increase in muscle PGC-1?? expression. Journal of

Biological Chemistry, 282(1), 194–199.

https://doi.org/10.1074/jbc.M606116200

ICOH 2019 - 1st International Conference on Health