Different Contribution of Estrogen Receptors, ET-1/ETBR and

Superoxide Dismutase and in eNOS Availibility based on Sexual

Dimorphism in Early Stage of Kidney Diabetic Rats

Anisa Fatwa

1,2,3 a

, Dwi Cahyani Ratna Sari

1 b

, Wiwit Ananda Wahyu Setyaningsih

Andrew

Nobiantoro

, Nur Arfian

Departement of Anatomy, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah Mada,

Yogyakarta,Indonesia

Master Program of Biomedical Science, Faculty of Medicine, Public Health and Nursing, Universitas Gadjah Mada,

Yogyakarta,Indonesia

Jakarta InVitro Fertilization, YPK MandiriHospital, Jakarta, Indonesia

Undergraduate International Program in School of Medicine, faculty of Medicine, Public Health and Nursing, Universitas

Gadjah Mada, Yogyakarta, Indonesia

Keywords: Early Stage Diabetes Mellitus, eNOS, ETBR, Estrogen Receptors, SOD

Abstract: Background Diabetes mellitus is metabolic diseases which is influenced by multifactorial conditions. Many

factors may contribute to DM progression, such as vasoconstrictor and vasodilator balance, as underlying

factor of endothelial dysfunction. Sex difference in male and female phenotype has not been elucidated in

DM progression, especially in eNOS availibility which associate with endothelin/endothelin receptors and

estrogen signaling. This research aims to elucidate the expression of ERα and Erβ, ppET1 via ETBR as

vasodilator properties, then SOD1 and SOD2 as antioxidant in male and female DM rats. Diabetes Mellitus

was induced in male and female rats with Streptozotocin 60mg/Kg.BB single injection intraperitonially.

Control group was injected with NaCl 0.9%. Rats were terminated at the 1st month. Proteinuria score and

histological structure were determined in all groups. Reverse Transcription-PCR was performed to know

mRNA expression of eNOS, ETBR, ERα and Erβ, SOD1 also SOD2 from kidney. All groups showed that

there were no significant differences in proteinuria score and histological structure related to persistent of

eNOS mRNA expression which confirmed by RT-PCR analysis. There were no significant differences

between eNOS mRNA expression in DM to control groups in each sex. Furthermore, ERα and ERβ mRNA

expression in female were significantly higher than male diabetic rats. Nevertheless, ETBR mRNA expression

was significantly higher in male compared to female diabetic rats. Then, female diabetic groups had higher

SOD1 and SOD2 mRNA expression compared to male. ERs and SOD upregulation in early diabetic female

rats and ETBR upregulation in early diabetic male rats might be associated with persistent eNOS expression

in early diabetic condition.

1 INTRODUCTION

The early stage of Diabetes Mellitus (DM) is

characterized by hyperfiltration, caused by

endothelial dysfunction in glomerular afferent

arterioles (Anderson et al., 1993). Endothelial

https://orcid.org/0000- 0002-6333-058X

https://orcid.org/0000- 0002-1126-4939

https://orcid.org/0000- 0002-4334-5012

https://orcid.org/0000- 0003-0296-3487

https://orcid.org/0000- 0003-1694-2054

dysfunction triggers the diabetic nephropaty which as

a Chronic Kidney Disease (Cheng et al., 2014). There

is a study that classified the stages of diabetic

nephropaty into two groups, early diabetic

nephropaty based on the beginning of GFR

(Glomerular Filtration Rate) enhancement, and the

Fatwa, A., Ratna Sari, D., Wahyu Setyaningsih, W., Nobiantoro, A. and Arﬁan, N.

Different Contribution of Estrogen Receptors, ET-1/ETBR and Superoxide Dismutase and in eNOS Availibility based on Sexual Dimorphism in Early Stage of Kidney Diabetic Rats.

DOI: 10.5220/0010489701750183

In Proceedings of the 1st Jenderal Soedirman International Medical Conference in conjunction with the 5th Annual Scientiﬁc Meeting (Temilnas) Consortium of Biomedical Science Indonesia

(JIMC 2020), pages 175-183

ISBN: 978-989-758-499-2

175

advanced stage of diabetes nephropaty starting from

the decrease of GFR (Eleftheriadis et a., 2013). This

classification easily determine the patient based on

the differences of vascular function in chronic kidney

disease, which nowadays still have a limited data.

Therefore there is a need for the approval of vascular

function in intial chronic kidney disease (Forbes et al.,

2003).

DM causes the endothelial dysfunction which is

affected by the decrease of Endothelial Nitric Oxide

(eNOS). eNOS helps relaxation of vascular smooth

muscle cells by activating Nitric Oxide directly (NO).

Stadler et al. (Stadler et al., 2003) revealed the

enhancement of eNOS in the early stages. There are

several potential vasoactive to increase NO

production, namely as estrogen hormone through the

estrogen receptors and endothelin-1 through the

ETBR. Increased oxidative stress is recognized as the

major metabolic abnormality involved in the

development of diabetic nephropaty. ROS production

is increased in endothelial and renal cells in

hyperglycemic conditions.

Increased oxidative stress also is recognized as the

major metabolic abnormality involved in the

development of diabetic nephropaty. ROS production

is increased in endothelial and renal cells in

hyperglycemic conditions. ROS can be dishminis by

antioxidant enzyme enzymes as though superoxide

dismutase, SOD1 and SOD2. But, The

overproduction of ROS diminishes expression of the

antioxidant. SOD1 is located in the cytoplasm, SOD2

in the mitochondria (Alejandra et al., 2016).

There is a study that suggests the possibility of

gender differences in the pathophysiology of the

disease. As in line as the studies, found that

nondiabetic premenopausal women have a lower risk

of having CKD and a slower rate of progression to

end-stage kidney disease compared to non-diabetic

men with the same age. There is a study that also

mentioned that sexual dimorphism affected the NO

system. Female rat has a higher NO level than males,

this is because eNOS can be converted by estrogen

into NO large amounts (Pesce et al., 2005).

There is no study about the expression of eNOS,

ET-1 ETBR, SOD1, SOD2, and Estrogen Receptors

based on sex and in the early stages of diabetes

mellitus. Therefore this study was conducted to assess

the differences in vasoprotector aspects namely as

estrogen receptor and ET-1 via ETBR which can

affect the changes of eNOS in female and male

diabetic rats in the early stages of diabetes. And also

SOD1 and SOD2, important antioxidant defense in

endothelial cells.

2 MATERIALS AND METHODS

We strongly encourage authors to use this document

for the preparation of the camera-ready. Please follow

the instructions closely in order to make the volume

look as uniform as possible (Moore and Lopes, 1999).

Please remember that all the papers must be in

English and without orthographic errors.

Do not add any text to the headers (do not set

running heads) and footers, not even page numbers,

because text will be added electronically.

For a best viewing experience the used font must

be Times New Roman, on a Macintosh use the font

named times, except on special occasions, such as

program code (Section 2.3.8).

3 MATERIALS AND METHODS

3.1 Samples

This research was conducted in Animal House

Anatomy Laboratory Universitas Gadjah Mada,

November 2019 – Januari 2020. This study was

approved by the Ethics Commission of the Faculty of

Public Health and Nursing at Universitas Gadjah

Mada with the number KE/FK/1445/EC/2019.

Sprague-Dawley rats (Rattus norvegicus) were used

in this study. The treatment group was divided into 4

groups with 6 rats in each group. This calculation uses

the Frederer formula. The division of these groups are

Control Female (CF), Diabetes Mellitus Female

(DMF), Control Male (CM) and DMM (Diabetes

Mellitus Male).

3.2 Animal Care

In this study, Sprague Dawley rats (3 months, 200-

300 grams) were obtained from the Animal Research

Unit. Rats are kept in plastic cages measuring

30x40x20 cm, at 23-25 ° C, 40-70% humidity, and

dark:light cycle every 12:12 hours. The rats were

acclimated for 1 week by adlibitum, given the

standard feed AIN-76A and boiled drinking water.

Type 1 DM models were prepared by injection of

Streptozotocin (60 mg / kgBB dissolved in 0.1 M

citric acid pH 4.5) with a single dose

intraperitoneally. Whereas the control group was

injected with NaCl. STZ injection was done after

acclimation for 7 days (8th day). Success was seen by

measuring glucose levels over 300 mg/dL. Tissue

collection was carried out after 1 month of animal

care. Right kidney for transcriptomic testing, fixed

JIMC 2020 - 1’s t Jenderal Soedirman International Medical Conference (JIMC) in conjunction with the Annual Scientiﬁc Meeting

(Temilnas) Consortium of Biomedical Science Indonesia (KIBI )

176

using RNAlater (Ambion) and immediately put in the

-20oC freezer while the left kidney was having a

fixation using formalin neutral buffer for histological

preparation.

3.3 RNA Extraction, cDNA Synthesis,

and Reverse Transcriptase

Polymerase Chain Reaction

Kidney tissue was extracted using Genezol RNA

solution (GENEzol™, Cat. No. GZR100) based on

the protocol from the manufacturer. The RNA

concentration was quantified using a nanodrop.

The RNA was synthesized into cDNA using cDNA

kit (Toyobo, Cat. No. TRT-101) with PCR. Reverse

transcriptase-polymerase chain reaction (RT-PCR)

was carried out to amplify the following specific

cDNAs.

RT-PCR was performed by mixing cDNA and

Taq Master Mix (GoTaq®Green Master Mix, Cat.

No. M7122). The PCR products were analyzed on 2%

agarose gel along with a 100-bp DNA ladder (Bioron,

Germany, Cat. No. 306009). The expression of the

genes was quantified with a densitometry analysis

using the ImageJ software. Β-actin expression was

used to normalize the expression

Table 1. Primers for PCR Analysis

Gen Sequence (5’ -> 3’)

ppET-1

Forwar

CTGGCTCTATGTAAGTCATGG

Reverse GCTCCTGCTCCTCCTTGATG

eNOS

Forwar

AAATCCACCCGAGCCACAAT

Reverse GGGCTGCCTTTTTCCAGTTG

Forwar

TCTCAGCCTTTTGTCCGAGC

Reverse CGCCGTTTTCAGTCTCGCA

SOD1 Forwar

GCGGTGAACCAGTTGTGGTG

Reverse AGCCACATTGCCCAGGTCTC

SOD2 Forwar

ATGTTGTGTCGGGCGGCGTGCAGC

Reverse GCGCCTCGTGGTACTTCTCCTCGGTG

ERα

Forwar

CACACACGCTCTGCCTTGAT

Reverse GAGCCACCCTGCTGGTTCAA

ERβ Forwar

GCCAATCATGTGCACCAGTTCCTT

Reverse AAAGCCAAGAGAAACGGTGGGCAT

β-actin Forwar

GCAGATGTGGATCAGCAAGC

Reverse GGTGTAAAACGCAGCTCAGTAA

3.4 Periodic Acid Schiff Staining

Deparaffinization was done by dipping the glass in

xylol and then dipping it in alcohol level 96% to 30%

after organ embedded in paraffin. The preparations

were then washed using distilled water (Aquades).

Then dipped in 1% alcian blue for 5 minutes. Then

dipped it in 1% periodic acid for 5 minutes. Dipped it

in Schiff reagent for 3-5 minutes then washed it using

flow water for 10 minutes. Then the level of alcohol

dehydration was done from 30% to 96%. Mounted

using an entelan.

3.5 Data Analysis

All data from RT-PCR were tested for Saphiro Wilk's

normality and continued with the One-way Anova or

Kruskall Wallis test, comparing CF and DMF, CM

and DMM, DMF and DMM.

4 RESULTS

4.1 Proteunia Score, Blood Gucose

Levels and Kidney Histology

Measurement of protein levels was also carried out to

determine the function of kidney filtration [8]. The

results of blood glucose and protein levels are as

follows:

Blood glucose levels in the DM group both males

and females had levels >300 g / dl and the value was

significant for the control group (p<0.05), which

means this group had hyperglycemic conditions.

While the protein content in the urine in the DM

group was not significantly different compared to the

Different Contribution of Estrogen Receptors, ET-1/ETBR and Superoxide Dismutase and in eNOS Availibility based on Sexual

Dimorphism in Early Stage of Kidney Diabetic Rats

177

control group in each gender. it could be said that the

kidney was considered to be able to carry out its

functions properly. This can be proven with the

following histological preparations:

Table 2. Protein levels in urine (mg / 100mL) and blood sugar (g / dL) mice after being injected with STZ 1 month before

Level CF DMF CM DMM

Blood glucose (g/dL) 106,33 ± 11,5 531,33 ± 99,25

231,5 ± 29,13 497 ± 103, 15

Urine protein (mg/100mL) 16,67 ± 15,05 25 ± 12,24 15 ± 16,43 25 ± 12,24

# Values in the same line show significant differences (p≤0.05) versus controls of the same gender. Mean ± Standar

deviation.

Figure 1. Histological structure of rat kidneys in the early stages of diabetes by PAS staining. The mark of shows

synechiae, shows infiltration of imflamatory cells.

4.2 eNOS mRNA Expression

The picture above implies that there have not been

any noticeable changes in the glomerulus and renal

tubules in the diabetes group when compared to the

control group in both males and females. There was

no visible loss of brush border in proximal tubule and

intraluminal cast which is a marker of tubular injury.

However, in DMB there were accumulation of

inflammatory celss in the insterstitial area. It did not

occur in DMJ. In addition, although the glomerulus

of the DM group had synechiae, there was no visible

thickening of the basement membrane (Setyaningsih

et al., 2017; Haryono et al., 2018).

The results obtained from eNOS gene

amplification showed that there was no significant

difference in the STZ injection treatment compared

with controls in each gender (p> 0.05) as well as

between the male DM rat group and the female DM

group (p> 0.05).

JIMC 2020 - 1’s t Jenderal Soedirman International Medical Conference (JIMC) in conjunction with the Annual Scientiﬁc Meeting

(Temilnas) Consortium of Biomedical Science Indonesia (KIBI )

178

Figure 2. eNOS mRNA Expression in Rat Kidney in Early Stag Diabetes Models

Figure 3. Estrogen receptor mRNA expression in rat kidney in early stage diabetes models. * shows a significant difference

(p≤0.05).

Figure 4. Estrogen receptor mRNA expression in rat kidney in early stage diabetes models. * shows a significant difference

(p≤0.05).

Different Contribution of Estrogen Receptors, ET-1/ETBR and Superoxide Dismutase and in eNOS Availibility based on Sexual

Dimorphism in Early Stage of Kidney Diabetic Rats

179

4.3 Estrogen Receptors mRNA

Expression

The result showed that there was no significant

differences between the control group and the DM

group in the ERα and ERβ genes in both male and

female gender (p> 0.05). In female, estrogen receptor

gene amplification in the DM group showed an

upward trend, whereas in male species tended to

decrease.

4.4 ppET-1/ ETBR mRNA Expression

The ppET-1 mRNA expression showed that there was

no significant differences between the control groups

of female and female DM, male and male DM control

and between female DM and male DM (p> 0.05).

Whereas in the ETBR gene the results obtained

showed significance in the male DM group compared

with the female DM group. Male DM group had

higher gene expression than female DM groups

(p≤0.05). These results can be chosen from the

following histogram:

4.5 SOD1 and SOD2 mRNA

Expression

From the picture above, there was no significant

difference in SOD1 mRNA expression in the female

groups, whereas the DMM was lower than their

control. The figure also showed that DMF mRNA

expression was higher than DMM. Meanwhile, the

expression of SOD2 mRNA in the DM group was

higher than the control group in each sex. While the

male and female DM groups did not have significant

differences, but had a tendency for DMF to be higher

than DMJ.

Figure 5. Expression of SOD1 and SOD2 mRNA in rat kidney in early stage diabetes models. * shows a

significant difference (p≤0.05)

5 DISCUSSIONS

In the early stages of diabetes, levels of Nitric Oxide

(NO) increase while in the advanced stages of

diabetic nephropaty, the NO levels decrease

(Nakagawa et al., 2008). The study was confirmed by

the research of Stadler et al. (2003) which stated that

an increase in eNOS works as a vasodilator of blood

vessels.

The results obtained from eNOS gene

amplification showed that there was no significant

difference in the STZ injection treatment compared

with controls in each gender as well as between the

male DM rat group and the female DM group. The

results obtained are not in accordance with the theory,

it is possible because the kidneys used in this study

was the entire kidney, which consist of the cortex and

medulla while according to the study of Han et al.,

(Han et al., 2005) stated that there are a differences in

the concentration of eNOS expression in the renal

cortex and medulla. The expression of eNOS in the

renal medulla is higher than the cortex, especially in

the arcuate and interlobular arteries. This can be taken

into consideration because there may be the NO

donors between the cortex and medulla (Nakagawa et

al, 2008). Kidney Vascular Tree protein isolation also

proves that there is a significant increase in eNOS in

the early stage of diabetic rats rather than isolation of

all parts of the kidney by immunoblotting methods

(De Vriese et al., 2001).

In diabetic kidney, there are hemodynamic

changes characterized by hyperfiltration (Hadi et al.,

2007). The enhancement of GFR is associated with

glomerular hyperfusion caused by the reduction of

intrarenal vascular resistance and hypertension from

glomerular capillaries resulting in the decreased

blood flow of preglomerular resistant blood vessels

JIMC 2020 - 1’s t Jenderal Soedirman International Medical Conference (JIMC) in conjunction with the Annual Scientiﬁc Meeting

(Temilnas) Consortium of Biomedical Science Indonesia (KIBI )

180

compared to postglomerular. Although renal (kidney)

vasodilation experiments in diabetes are still under

debate, some researchers suggest that an

enhancement in NO associated with hyperfiltration in

the initial diabetes is supported by the administration

of L-arginine which is an endogenous inihibitor

eNOS and the administration of NOS blockers that

prevent excessive hypefiltration and decrease normal

GFR in the early stages of animals testing the of

diabetes (Diederich et al., 1994).

Another consideration of the causes of eNOS

results that are not significant between treatments is

the evaluation of other factors that may be responsible

for the changing response (both increasing and

decreasing) in the early stages of diabetes. One

example of an experiment that caused no change in

eNOS in the early stages of diabetes in the study was

the inability of daltobran, which is an antagonist of

the Tromboxan A2 receptor, in blood vessel

relaxation in the 8th week. This happens because

vasoconstrictor agents are still stronger than

daltobran (Wells et al., 2005).

In this study, gender also affects the differences in

eNOS concentrations. Estrogen through estrogen

receptors modulating eNOS to relax blood vessels is

also one of the factors that can be evaluated, whereas

in the male sex, estrogen is not found in abundant

quantities. The result showed that there was no

significant differences between the control group and

the DM group in the ERα and ERβ genes in both male

and female gender. In female, estrogen receptor gene

amplification in the DM group showed an upward

trend, whereas in male species tended to decrease.

However, there were significant differences between

female DM groups and male DM groups. The male

DM group was lower than the female DM group on

the amplification results of the two estrogen receptor

genes. This is possible due to the mention that sexual

dimorphism affects the NO system. Female mice

have a higher NO level than males (Stadler et al.,

2003)..

Wells et al., (Diederich et al., 1994) confirmed

this study by stating that the condition of

hyperglycemia in animal models was followed by a

tendency for increased expression of ERα protein in

the female DM group and a decreased tendency in the

DM group with male. Similarly, the expression ERβ.

The study also mentions that there has been a

decrease in estrogen levels in blood in male and

female DM rats that are not directly caused due to

hyperglycaemia, but are directly caused by the

absence of insulin which can reduce the ability to

convert androgens to estrogen or decrease aromatase

activity (Barkhem et al., 1998). The relations between

DM and estrogen can be proven by the presence of

menstrual disorder that often occurs in diabetics who

cause abnormal ovarian hormone synthesis. This

implies that the regulation of estrogen receptors is not

directly caused by hyperglycemia but is caused by the

hormone estrogen itself. In addition, the increase in

estrogen receptors in female DM groups may be due

to estrogen through estrogen receptors which are

known to regulate glucose uptake and increase insulin

sensitivity (Weels et al., 2005).

Endothelin-1 is also one factor that must be

considered because Endothelin-1 is a powerful

vasoconstrictor with mitogenic, prooxidative and

proinflammatory abilities of vascular function that is

significant to vascular function. Excessive production

and functional improvement of ET-1 are reported to

be agents of development of diabetic nephropaty

(Pernow et al., 2012). Whereas ET-1 regulation

through ETBR will cause relaxation of blood vessels.

The ppET-1 mRNA expression showed that there was

no significant differences between the control groups

of female and female DM, male and male DM control

and between female DM and male DM. Whereas in

the ETBR gene the results obtained showed

significance in the male DM group compared with the

female DM group. Male DM group had higher gene

expression than female DM groups.

There was no differences in ppET-1 mRNA

expression in the early stages of diabetes mellitus in

each treatment group. This is different from the

theory that gender affects the expression of ET-1.

Pesce et al. mentions female rats have higher NO

levels than males. This is proven by the

administration of testosterone in transsexuals causing

increased levels of ET-1 (Polderman et al., 1993).

Expression of ppET-1 gene that was not significantly

different between DM groups in each gender was

possible because estrogen did not affect ppET-1

levels at mRNA levels. This was evidenced by

expression of ECE (Endhotelin Converting Enzyme)

which did not differ between treatments (Nuedling et

al., 2003).

ETBR expression in the male DM group was

higher than females. It might be said that the stable

state of eNOS in the DM group compared to the

control in the male group was due to high ETBR

expression. So that it can activate eNOS and produce

NO. ETBR is expressed in endothelial cell muscle,

ETBR is responsive to all ET isoforms that cause

vasodilation by releasing NO and PGI2 (Soe et al.,

1994). This evidence allows that ETBR is used as a

vasodilator for blood vessel protection in male rats. In

addition, estrogen has the ability to derive ETBR

regulation through structures known from the ERE

Different Contribution of Estrogen Receptors, ET-1/ETBR and Superoxide Dismutase and in eNOS Availibility based on Sexual

Dimorphism in Early Stage of Kidney Diabetic Rats

181

(estrogen response element) found in the 5 'upstream

region of the ETBR gene (Cheng et al., 1993).

Diabetes can increased oxidative stresses that

occurs when reactive oxygen species (ROS) leviated.

Then, antioxidant was formed as defence system. 4,

25. Enzyme superoxide dismutase can formed

hydrogen peroxide as a stable product of ROS from

free radicals in response to inflammatory conditions

32. Based on the results, mRNA expression SOD1

and SOD2. in DMF groups was higher than DMM. It

might be associated with estrogen can act as potensial

antioxidant which could contribute to eNOS

persistent 22, even SOD1 in DMF is noteworthy than

CF. Less of SOD is needed in women compared to

men who will not benefit from the antioxidant

properties of estrogen. Hamed et al. found that SOD

can restores NO production and ability of glucose-

stressed endothelial progenitor cells.

6 CONCLUSIONS

Estrogen receptors and superoxide dismutase

upregulated in early diabetic female rats. They can

provide signal for good function of endothelial cell.

Moreover, ETBR upregulated in early diabetic male

rats might be associated with persistent eNOS

expression in early diabetic condition. ETBR

knockout in diabetics rats can be used to demonstrate

ppET-1/ ETBR signaling for vascular relaxation via

eNOS in males.

REFERENCES

Anderson, S., Jung, F.F., and Ingelfinger J.R., 1993. Renal

renin-angiotensin system in diabetes: functional,

immunohistochemical, and molecular biological

correlations. Am J Physiol. 265(4), pp. 477-86.

Cheng, H and Harris, R C, 2014. Renal endothelial

dysfunction in diabetic nephropathy. Cardiovasc

Hematol Disord Drug Targets. 14(1), pp. 22-33.

Eleftheriadis, E., Antoniadi, G., Pissas, G., Liakopoulos,

V., and Stephanidis, I., 2013. The renal endothelium in

diabetic nephropathy. Ren Fail. 35(4), pp. 592-9.

Forbes, J.M., Cooper, M.E., Oldfield, M.D, and Thomas,

M.C, 2003. Role of advanced glycation end products

in diabetic nephropathy. J Am Soc Nephrol, 14, pp.

254–8.

Stadler, K., Jenei, V., Azy, G.V., Somogyi, A and Jakus, J.,

2003. Increased nitric oxide levels as an early sign of

premature aging in diabetes. Free Radic Biol Med,

35(10), pp. 1240-51.

Alejandra, G.M., Leonardo, P., Francisco, G.Y and Jorge,

A., 2016. Oxidative stress in diabetic nephropathy

with early chronic kidney disease. J Diabetes Res,

2016, pp. 1-7.

Pesce, J.H.C., Zheng, W., Kim, J., Kim, J., Zhang, Y.,

sMenini, S, et al., 2005. Sex differences in renal injury

and nitric oxide production in renal wrap hypertension.

Am J Physiol Heart Circ Physiol, 288, pp. 43-7.

Verdiansyah., 2016. Kidney function diagnose. CDK-

237.Elsevier, 43(2), pp. 148-54.

Setyaningsih, W., Arfian, N., Suryadi, E., Romi, M.M.,

Tranggono, U. and Sari, D.C.R., 2017. Hyperuricemia

induces Wnt5a / Ror2 gene expression, epithelial –

mesenchymal transition (EMT) and kidney tubular

injury in mice. Iran J Med Sci, 41(2), pp. 1–10.

Haryono, A., Nugrahaningsih, D.A., Sari, D.C.R., Romi,

M.M and Arfian, N., 2018. Reduction of serum uric

acid associated with attenuation of renal injury,

inflammation and macrophages M1/M2 ratio in

hyperuricemic mice model. Kobe J Med Sci, 64(3),

pp. 107-14.

Nakagawa, T., Tanabe, K., Croker, B.P., Johnson, R.J.,

Grant, M.B., Kosugi, T, et al., 2008. Endothelial

dysfunction as a potential contributor in diabetic

nephropathy. Nat Rev Nephrol, 7, pp. 36–44.

Han, K.H., Lim, J.M., Kim, W.Y., Kim, H., Madsen, K.M

and Kim, J., 2005. Expression of endothelial nitric

oxide synthase in developing rat kidney. Am J Physiol

Renal Physiol, 288(4), pp. 694–702

Nakagawa, T., Sato, W., Glushakova, O., Heinig, M.,

Clarke, T., Campbell- Thompson, M., et al., 2008.

Diabetic endothelial nitric oxide synthase knockout

mice develop advanced diabetic nephropathy. J Am

Soc Nephrol, 18, pp. 539-50.

De Vriese, A.S., Stoenoiu, M.S., Elger, M., Devuyst, O.,

Vanholder, R., Kriz, W, et al., 2001. Diabetes-induced

microvascular dysfunction in the hydronephrotic

kidney: role of nitric oxide. Kidney Int, 60(1), pp. 202-

10.

Hadi, H.A and Suwaidi, J.A., 2007. Endothelial dysfunction

in diabetes mellitus. Vasc Health Risk Manag, 3(6)

pp., 853-76.

Diederich, D., Skopec, J., Diederich, A and Dai, F.X., 1994.

Endothelial dysfunction in mesenteric arteries of

diabetic rat: role of free radicals. Am J Physiol,

266(35), pp. 1153-61.

Wells, C.C., Riazi, S., Mankhey, R.W., Bhatti, F.,

Ecelbarger, C. and Maric. C., 2005. Diabetic

nephropathy is Associated with decrease circulating

estradiol levels and imbalanced in the expression of

renal Eetrogen receptors. Gend med, 2(4), pp. 227-37.

Barkhem, T., Carlsson, B., Nilsson, Y., Enmark, E.,

Gustafsson, J and Nilsson, S., 1998. Differential

response of estrogen receptor alpha and estrogen

receptor beta to partial estrogen agonists/ antagonists.

Mol Pharmacol, 54, pp. 105-12.

Pernow, J., Shemyakin, A and Bohm, F., 2012. New

perspectives on endothelin-1 in atherosclerosis and

diabetes mellitus. Life Sci, 91, pp. 507-16.

Polderman, K.H., Stehouwer, C.D., Van Kamp, G.J.,

Dekker, G.A., Verheugt, F.W and Gooren, L.J., 1993.

JIMC 2020 - 1’s t Jenderal Soedirman International Medical Conference (JIMC) in conjunction with the Annual Scientiﬁc Meeting

(Temilnas) Consortium of Biomedical Science Indonesia (KIBI )

182

Influence of sex hormones on plasma endothelin

levels. Ann Intern Med, 118, pp. 429-32.

Nuedling, S., Van Eickles, M., Alle’ra, A., Doevendans, P.,

Meyer, R., Vetter, H., 2003. 17β-Estradiol regulates

the expression of endothelin receptor typeB in the

heart. Br J Pharmaco, 40(1), pp. 195-201.

Soe, B., Oemar, B.S, Siebenmann, R., Von Segesser, L. and

Lüscher, T.F., 1994. Both ETA and ETB receptors

mediate contraction to endothelin-1 in human blood

vessels. Circulation, 89, pp.1203-8.

Cheng, H.F., Su, Y.M., Yeh, J.R and Chang, K.J., 1993.

Alternative transcript of the nonselective-type

endothelin receptor from rat brain. Mol Pharmacol,

44, pp. 533-8.

Haidara MA, Yassin HZ, Rateb M, et al. Role of oxidative

stress in development of cardiovascular complications

in diabetes mellitus. Curr Vasc Pharmacol. 2006; 4:

215–27.

Yang, D., Li, J., Yuan, Z and Liu, X., 2013. Effect of

hormone replacement therapy on cardiovascular

outcomes: a meta-analysis of randomized controlled

trials. PLoS One, 8, pp. e62329.

Bell, J.R., Bernasochi, G.B., Varma, U., Raaijmakers,

A.J.A and Delbridge, L.M.D., 2013. Sex and sex

hormones in cardiac stress mechanistic insights. J

Steroid Biochem Mol Biol, 137, pp. 124–35.

Hamid, S., Brenner, B., Aharom, A., Daoud, D and Roguin,

A., 2009. Nitric oxide and superoxide dismutase

modulate endothelial progenitor cell function in type 2

diabetes mellitus. Cardiovas. Diabetol, 8(56), pp. 1-

12.

Different Contribution of Estrogen Receptors, ET-1/ETBR and Superoxide Dismutase and in eNOS Availibility based on Sexual

Dimorphism in Early Stage of Kidney Diabetic Rats

183