Cloning, Expression and Sequence Analysis of PbeHSFA1d in Pyrus

betulifolia

Cong Jin

and QiaoHui Guo

School of Life Science and Food Engineering , Meicheng Street, Huaian, China

Keywords: Pyrus Betulifolia, Pbehsfa1d Gene, Gene Cloning, Abiotic Stress, Expression Analysis.

Abstract: Heat shock protein is a kind of transcription factors widely existing in plants, which plays a major role in

regulating plant growth and responses to environmental stress. In order to study the sequence characteristics

of HSF gene from pear and its response to abiotic stress, PbeHSFA1d gene was isolated from Pyrus

betulifolia by RT-PCR. Sequence analysis of PbeHSFA1d was carried out by bioinformatics software, and

real time quantitative PCR was used to detect the expression level of PbeHSFA1din different tissues and its

response patterns to various abiotic stresses. The results reflected that the ORF of PbeHSFA1d was 1548 bp

in length, 516 amino acids were encoded, and there were 52 phosphorylation sites in the predicted protein,

but the glycosylation site was not found. Domain analysis showed that PbeHSFA1d contained a conserved

N-terminal DNA binding domain (DBD), a bipartite oligomerization domain (HR-A/B), an activation

domain (AHA), a nuclear localization signal (NLS) and a nuclear export signal (NES), which are typical

structural features of plant HSF protein family. Moreover, PbeHSFA1d was close to MdHSFA1d, PaHSF8,

PpHSF8 and PdHSFA1d in genetic relationship. PbeHSFA1d was localized to the nucleus by subcellular

localization. The results of RT-PCR demonstrated that the expression of PbeHSFA1d in stem was higher

than that in flower, leaf and root, and the transcript levels of PbeHSFA1d were induced by high temperature,

dehydration, low temperature and salt. The results of this study will provide a theoretical basis for further

exploration of the function in abiotic stress of PbeHSFA1d.

1 INTRODUCTION

During the last decades, heat has gradually become

an important environmental factor seriously

affecting plant growth and yield with global

warming. Therefore, plants have formed a series of

molecular and physiological mechanisms to resist

environmental stress in the long-term evolution

process (Gall 2015). As an important regulator of

gene expression, transcription factors participate in a

set of plant protection mechanisms under

environmental stresses, indicating that transcription

factors play an essential role in improving plant

stress resistance, such as bZIP, NAC, bHLH and

HSF (Tang 2020).

The response of plants to heat is a extremely

complex process, which involves a wide range of

genes that related to abiotic stress, signal

transduction, material transport, photosynthesis,

https://orcid.org/0000-0001-6732-0648

https://orcid.org/0000-0002-3098-8166

protein metabolism and carbohydrate metabolism

gene (Tian 2021). Since the first plant HSF (heat

shock transcription factor) gene was cloned from

tomato, there are 21, 52, 25 and 30 members in

Arabidopsis, soybean, rice and maize, respectively

(Yoshida 2011). As a large transcription factor

family in plants, HSF is the core regulator of heat

stress response genes in higher plants (Qiao 2015).

HSF could specifically recognize and bind heat

shock elements, and then activate the expression and

transcription of downstream heat shock protein

genes to produce heat shock proteins, so as to

improve the heat resistance of plants. HSF has five

typical functional domains: DBD, HR-A/B domain,

NLS, NES and AHA (Li 2020). HSF can be further

divided into A, B and C types in plants, and A-type

HSF contains AHA structure, which mostly plays a

positive regulatory role in the response to heat stress,

while most of B-type HSF play a negative regulatory

role in the response to heat stress. Several studies

have shown that HSF could respond not only to heat,

but also to cold, drought, oxidative stress and salt

Jin, C. and Guo, Q.

Cloning, Expression and Sequence Analysis of PbeHSFA1d in Pyrus betulifolia.

DOI: 10.5220/0011200700003443

In Proceedings of the 4th International Conference on Biomedical Engineering and Bioinformatics (ICBEB 2022), pages 277-282

ISBN: 978-989-758-595-1

277

(Tian 2021, Liu 2021). HSFA1b enhances heat

tolerance in wheat and Arabidopsis through

jasmonate signalling pathway and OPR3 (Tian

2020). AtHSFA2 is involved in drought and

oxidative stress in Arabidopsis (Nishizawa 2006). In

addition, AtABI3 positively regulates the expression

of AtHSFA9 by directly binding to its promoter, but

AtHSFA9 is negatively regulated by AtIAA27

(Kotak 2007).

So far, although many HSF transcription factors

that respond to plant development and abiotic stress

have been identified, but most of these studies focus

on Arabidopsis and crops, and there are still few

studies on HSF transcription factors in woody

plants. Pyrus betulifolia is a heat-tolerant species,

making it an ideal source to isolate gene. In this

study, the full length of PbeHSFA1d of Pyrus

betulifolia was cloned by reverse transcription PCR.

The sequence analysis was carried out by

bioinformatics software, and the tissue expression

level and the pattern of expression to abiotic stress

were studied by quantitative PCR, in order to prove

the function and stress resistance mechanism of

PbeHSFA1d.

2 MATERIALS AND METHODS

2.1 Plant Materials

Healthy and uniform seedlings were collected from

60-day-old Pyrus betulifolia, which were exposed to

abiotic stresses of low temperature (4℃), high

temperature (40℃), dehydration and salt (200

mmol·L

-1

NaCl).

2.2 Stress Treatments

Temperature stresses were carried out by placing the

seedlings in a growth incubator at the set 4℃or 40℃

for 0, 6, 12, 24, 48 h, respectively. Before

dehydration and salt treatment, the roots of seedlings

were placed in a beaker containing distilled water,

which were grown in a growth chamber at 25°C for

1 day, had a 16-h light/8-h dark photoperiod. For the

dehydration treatment, the seedlings were put on the

dry filter papers dried at 25°C in an artificial climate

chamber, with relative humidity of 40.0% for 0, 0.5,

1, 3 and 6 h. Salt treatment was applied by

transferring the seedlings to flasks with 200 mmol·L

NaCl solution for 0, 6, 12, 24 and 48 h. At least 50

seedlings were used in each treatment, and the fully

expanded leaves were collected from randomly 3-4

seedlings at set time points. All the samples of each

treatment were mixed and put into the liquid

nitrogen frozen immediately, then stored at -80°C

for further experiments.

2.3 Gene Isolation

Based on the pear genome database, a sequence with

a complete opening reading frame, high degree of

similarity to MdHSFA1d was obtained, named as

PbeHSFA1d. The 2000 bp upstream of the

transcription start site of PbeHSFA1d gene was

selected as the promoter sequence. Based on the two

sequences, specific primers GSP1 and GSP2 were

designed for amplifying the gene and promoter by

using cDNA and DNA in the leaves of Pyrus

betulifolia as templates, respectively. The PCR

mixture in a total 20 μL reaction volume, contained

100 ng cDNA, 10 μL I-5

2X High-Fidelity Master

Mix, 0.4 μM of a pair of specific primers and

nuclease-free water. PCR was performed by a

program as follows: initial denaturation at 98°C for

1 min, 35 cycles of 98°C for 10 s, 56°C for 15 s,

72°C for 90 s, and 72°C for 10 min. The PCR

product of gene cloning was purified and cloned into

pCAMBIA1300 vector to generate a fusion

construct (pCAMBIA1300-PbeHSFA1d) and

sequenced in Sangon. The promoter of PbeHSFA1d

product was subcloned into pMD-18T vector and

sequenced in Sangon.

2.4 Sequence Analysis of PbeHSFA1d

The molecular weight and isoelectric point (pI) were

calculated by Expasy

(http://web.expasy.org/compute_pi/); The cis acting

elements in the promoter that related to

environmental stress was detected by the online tool

of Plant CARE; Subcellular localization was

analyzed by software Softberry; The secondary and

three-dimensional structures of PbeHSFA1d protein

were predicted by software Sopma and SWISS-

MODEL (Waterhouse 2018), respectively; The

protein modification patterns were analyzed by

software Netphos 3.1 server and Dictyglyc 1.1

server; The multiple alignments of the deduced

amino acid sequence were carried out by the Clustal

W program (Jin 2017); The protein functional

domain was analyzed by software Pfam;

Phylogenetic tree was constructed by the Maximum

Likelihood method using MEGA 6.0.

ICBEB 2022 - The International Conference on Biomedical Engineering and Bioinformatics

278

2.5 Analysis of PbeHSFA1d Gene

Expression Characteristics

Based on the confirmed PbeHSFA1d sequence, a

pair of specific expression primers (GSP3) were

designed. Quantitative Real-Time PCR (qRT-PCR)

was performed to analyze the expression levels in

different tissues and expression patterns under

various abiotic stresses of PbeHSFA1d, the primer

of internal reference gene was GSP4. The PCR

solution in a total 20 μL reaction volume, contained

10 ml of SYBR-Green PCR Master Mix, 0.25 mM

of each primer, 100 ng of cDNA, and nuclease-free

water. Quadruple qPCR was carried out in a

LightCycler 480 Real-Time PCR System, the PCR

reaction conditions were as follows: 95 °C for 5 min,

then 40 cycles of 94 °C for 10 s, 60 °C for 30 s,

72 °C for 30s, and 72 °C for 3 min. Relative gene

expression levels of the amplified products were

normalized to Pyrus TUB-b2 to minimize variation

in the cDNA template and the relative gene

expression data were calculated by the 2

− ΔΔCT

method.

2.6 Statistical Analysis

The experimental results are at least three

independent replicates in this study, shown as mean

± SE. Experimental data were analyzed using SPSS

software and statistical difference was compared

based on Duncan’s multiple range test.

Table 1: Primer sequences.

Primer Primer Sequence (5ʹ-3ʹ) Function

GSP1-F GAGAACACGGGGGACTCTAGAAT

GGAGGCTGCTAATAACAAC

Gene

cloning

GSP1-R GCCCTTGCTCACCATGGATCCCAC

CCCTTTGGTCTCTGATG

GSP2-F AACAAATGAACGGTATTGGTAA

Promoter

cloning

GSP2-R CAATTCTTTTATTGTTCTCTGTG

GSP3-F GAGCATCAATCGGCGTAA

QRT-

PCR

GSP3-R CTGCACCATTGTTTGTAGCT

GSP4-F TGGGCTTTGCTCCTCTTAC

Internal

control

GSP4-R CCTTCGTGCTCATCTTACC

3 RESULTS

3.1 Sequence Analysis of PbeHSFA1d

The target fragment was amplified by using specific

cloning primers with the cDNA from the leaves of

Pyrus betulifolia as the template, sequencing results

showed that the fragment was consistent with the

PbeHSFA1d. The full length of is 1548 bp, encoding

516 amino acids.

In order to further speculate the potential

function of PbeHSFA1d, the cis acting elements of

promoter were analyzed. The results showed that a

various of cis acting elements related to

environmental stress (MBS, LTR, STRE, TC-rich

repeats, ARE and so on) and hormone (ABRE,

TCA-element, ERE, TGACC-motif, GARE-motif,

and so on) in the promoter, which suggested that

PbeHSFA1d might play a key role in plant defense

against abiotic stresses and response hormones.

3.2 Sequence and Bioactivity Analysis

of PbeHSFA1d

The predicted molecular weight of PbeHSFA1d

was about 57.141 kDa, the theoretical isoelectric

point was 4.8, the instability index was 56.67, and

the hydrophilicity coefficient was - 0.697, indicating

that PbeHSFA1d belonged to unstable hydrophilic

protein; The results of signal peptide analysis

showed that there was no signal peptide sequence in

PbeHSFA1d, which belonged to non-secretory

protein; The prediction of subcellular localization

showed that PbeHSFA1d was mainly located in the

nucleus. The results of protein secondary structure

prediction showed that PbeHSFA1d contained

32.75% α- Helix, 9.11% extension chain, 5.62% β-

Corner and 52.52% random coil; The protein tertiary

structure of PbeHSFA1d was analyzed by using HSF

protein template (PDB ID:1fbu.1) in SWISS-

MODEL software, ratio of the coverage of the

constructed model and template was 50% and the

amino acid coverage range was 41-116 aa.

Phosphorylation and glycosylation, as the

common protein modifications, may greatly affect

the protein structure and function in the process of

plant growth and development. The phosphorylation

analysis of PbeHSFA1d showed that 52

phosphorylation sites exceeded the probability

threshold, including 40 serine sites and 12 threonine

sites, and there were dense phosphorylation sites in

the amino acid sequence range 290-350 aa (Figure

1). Glycosylation prediction analysis showed that

there were no sites that exceed the probability

threshold, which indicated glycosylation of

PbeHSFA1d protein was highly likely.

Cloning, Expression and Sequence Analysis of PbeHSFA1d in Pyrus betulifolia

279

Figure 1: Prediction of phosphorylation site in amino acid

sequence of PbeHSFA1d protein.

3.3 Phylogenetic and Sequence

homology Analysis of PbeHSFA1d

Phylogenetic analysis showed that PbeHSFA1d had

a close relationship with MdHSFA1d, PaHSF8,

PpHSF8 and PdHSFA1d of Rosaceae, and clustered

together; Besides that, PbeHSFA1d had a distant

relationship with ZjHSF8, GmHSF33 and

SsHSFA1d (Figure 2).

Figure 2: Phylogenetic tree of PbeHSFA1d and HSFs of

other species.

Multiple sequence alignment analysis was

performed between PaHSF8, PpHSF8, FvHSFA1d,

RcHSFA1d, MdHSFA1d and PbeHSFA1d, the

results showed that the sequence similarity

respectively was 77.50%, 79.03%, 73.29%, 73.84%

and 95.16%, which indicated PbeHSFA1d had high

homology with these five species and including a

conserved N-terminal DBD domain, a HR-A/B

domain, a NLS, AHA and NES. In addition,

PbeHSFA1d possessed an AHA domain which is

specific to A-type HSF transcription factors in

plants, all of those proved that PbeHSFA1d was a A-

type HSF transcription factor (Figure 3).

Figure 3: Multiple alignment of HSF proteins.

3.4 Tissues Specific Expression of

PbeHSFA

HSFs were expressed in different tissues of plant,

and with a certain degree of tissue specificity.

Therefore, the expression levels of PbeHSFA1d in

Pyrus betulifolia different tissue of flower, leaf, stem

and root were analyzed (Figure 4). The result

indicated that PbeHSFA1d was expressed in all

tested tissues, with the highest transcription level in

stem and the least in flower, which demonstrated the

significant tissue expression specificity of

PbeHSFA1d.

Figure 4: Expression of PbeHSFA1d in various tissues.

3.5 Expression Characteristics of

PbeHSFA1d under Different

Stresses

The qRT-PCR was performed to detect the

tanscription levels of PbeHSFA1d under various

treatments, including low temperature (4℃), high

temperature (40℃), salt and dehydration. For all

treatments, the expression of PbeHSFA1d was

higher than the initial level after treatment. Under

low temperature stress, PbeHSFA1d was

continuously induced and reached the highest level

at 24 h and declined at the last day (Figure 5A).

ICBEB 2022 - The International Conference on Biomedical Engineering and Bioinformatics

280

Under heat stress, expression profile was progressive

elevated until the highest level was reached at 12 h

(Figure 5B). As can be seen in Figure 5C,

PbeHSFA1d was sharply induced within 1 h, which

was 6 times that of initial level. The expression of

PbeHSFA1d reached the maximum level at 12 h

with salt treatment and then decreased continuously

(Figure 5D).

Figure 5: Relative expression pattern of PbeHSFA1d

under various abiotic stresses.

4 DISCUSSION

With the intensification of greenhouse effect, heat

stress has become one of the major limiting factors

that adversely affect plant development and crop

yield. Under heat stress, HSF can regulate the

expression of heat shock genes and produce HSP,

which is considered to be the central transcription

factor to resist heat stress. Although several HSFA1d

genes have been isolated, there are differences in

tissue expression patterns and response levels under

abiotic stress (Tang 2020, Ohama 2017). Identifying

HSFA1d in different species will lay a foundation

for further study of the function and application.

In this study, the PbeHSFA1d of Pyrus betulifolia was

cloned, the ORF has a total length of 1548 bp, encodes

516 amino acids and contains 52 phosphorylation sites,

which suggest PbeHSFA1d will play extensive role in the

regulation of phosphorylated proteins (Shen 2019). Cis

acting elements are mainly involved in gene expression

regulation, several stress-related cis acting elements such

as MBS, LTR, STRE and ARE are predicted in the

PbeHSFA1d promoter, which are also found in the

promoter of AtHSFA1d that in response to a variety of

abiotic stresses, indicates the PbeHSFA1d may be

involved in the pathway of resistance to environmental

stress (Liu 2021). Multiple sequence alignment results

show that both PbeHSFA1d and homologous genes

contain the A-type HSFs key domains of DBD, HR-A/B,

NLS, AHA and NES, which are also the main motifs for

HSF to perform its functions (Li 2020). Evolutionary

analysis show that PbeHSFA1d is closely related to

MdHSFA1d, PdHSFA1d, PpHSF8 and PaHSF8, implying

that PbeHSFA1d is highly conservative in the process of

evolution.

HSFs are distributed in many tissues of plant and show

the tissue-specific expression. In this study, the expression

of PbeHSFA1d is higher in the stem and root, but lower in

the leaf and flower, which is similar to the tissue-specific

expression of PpHSF5 (Tan 2021). On the contrary, the

expression of CsHSFB2b is higher in fruit and leaf (Zhang

2020). The difference of tissue expression among

homologous genes may be related to their main

physiological functions. Several studies have shown that

the transcription level of HSFs is induced by a variety of

abiotic stresses, which affect the stress resistance of plants.

AtHSFA1d responds to chilling stress and promotes

hypocotyl elongation via enhancing expression of

ribosomal protein genes (Liu 2021). MdHSFA8A is

induced by drought and modulates flavonoid synthesis

(Wang 2020). Overexpression of TaHSFA2d and

AtHSFA2 improve salt tolerance by regulating stress

response (Chauhan 2013). As a major heat stress

transcription factor, AtHSFA1d improves heat tolerance

by regulating related gene expression (Higashi 2013). In

this study, PbeHSFA1d of Pyrus betulifolia is involved in

the response to cold, dehydration, heat and salt,

demonstrating that PbeHSFA1d may play an essential role

in the response to abiotic stress. However, the action

mechanism of PbeHSFA1d resistance to abiotic stress

needs to be further explored.

5 CONCLUSIONS

In this study, PbeHSFA1d was isolated from Pyrus

betulifolia and proved to be a A-type HSF protein by

sequence analysis. PbeHSFA1d was clustered with

MdHSFA1d, PaHSF8, PpHSF8 and PdHSFA1d in

evolutionary relationship. The expression of

PbeHSFA1d was the lowest in the flower and the

highest in the stem, showing significant tissue

expression specificity. PbeHSFA1d was induced by

low temperature, heat, salt and dehydration stress,

indicating that PbeHSFA1d may be involved in the

process of resistance to abiotic stress. In brief, the

present work lays a foundation for identifying the

function of PbeHSFA1d and other more work in the

future.

ACKNOWLEDGEMENTS

This work was supported by the National Natural

Science Foundation of China (31801829), the

Natural Science Foundation of Jiangsu Province

(BK20170463, BK20170462, BK20181062).

Cloning, Expression and Sequence Analysis of PbeHSFA1d in Pyrus betulifolia

281

REFERENCES

Chauhan, H., Khurana, N., Agarwal, P., Khurana, J.P.,

Khurana, P. (2013). A seed preferential heat shock

transcription factor from wheat provides abiotic stress

tolerance and yield enhancement in transgenic

Arabidopsis under heat stress environment. PLoS One.

8(11), e79577.

Gall, H. L., Philippe, F., Domon, J.M., Gillet, F., Pelloux,

J., Rayon, C. (2015). Cell wall metabolism in response

to abiotic stress. Plants. 4(1), 112-166.

Higashi, Y., Ohama, N., Ishikawa, T., Katori, T., Shimura,

A., Kusakabe, K., Yamaguchi-Shinozaki, K., Ishida,

J., Tanaka, M., Seki, M. (2013). HsfA1d, a protein

identified via FOX hunting using Thellungiella

salsuginea cDNAs improves heat tolerance by

regulating heat-stress-responsive gene expression.

Molecular plant. 6(2), 411-422.

Jin, C., Li, K.Q., Xu, X.Y., Zhang, H.P., Chen, H.X.,

Chen, Y.H., Hao, J., Wang, Y., Huang, X.S., Zhang,

S.L. (2017). A novel NAC transcription factor,

PbeNAC1, of Pyrus betulifolia confers cold and

drought tolerance via interacting with PbeDREBs and

activating the expression of stress-responsive genes.

Frontiers in plant science. 8, 1049.

Kotak, S., Vierling, E., Baumlein, H., Koskull-Doring, P.

(2007). A novel transcriptional cascade regulating

expression of heat stress proteins during seed

development of Arabidopsis. The Plant Cell. 19(1),

182-195.

Li, M., Xie, F., Li, Y., Gong, L., Luo, Y., Zhang, Y.,

Chen, Q., Wang, Y., Lin, Y., Zhang, Y. (2020).

Genome-Wide analysis of the heat shock transcription

factor gene family in Brassica juncea: structure,

evolution, and expression profiles. DNA and cell

biology. 39(11), 1990-2004.

Liu, H., Zhang, Y., Lu, S., Chen, H., Wu, J., Zhu, X., Zou,

B., Hua, J. (2021). HsfA1d promotes hypocotyl

elongation under chilling via enhancing expression of

ribosomal protein genes in Arabidopsis. The New

phytologist. 231(2), 646-660.

Nishizawa, A., Yabuta, Y., Yoshida, E., Maruta, T.,

Yoshimura, K., Shigeoka, S. (2006). Arabidopsis heat

shock transcription factor A2 as a key regulator in

response to several types of environmental stress. The

Plant journal. 48(4), 535-547.

Ohama, N., Sato, H., Shinozaki, K., Yamaguchi-

Shinozaki, K. (2017). Transcriptional Regulatory

Network of Plant Heat Stress Response. Trends in

plant science. 22(1), 53-65.

Qiao, X., Li, M., Li, L., Yin, H., Wu, J., Zhang, S.L.

(2015). Genome-wide identification and comparative

analysis of the heat shock transcription factor family

in Chinese white pear (Pyrus bretschneideri) and five

other Rosaceae species. BMC plant biology. 15, 12.

Shen, Q., Zhan, X., Yang, P., Li, J., Chen, J., Tang, B.,

Wang, X., Hong, Y. (2019). Dual activities of plant

cGMP-Dependent protein kinase and its roles in

Gibberellin signaling and salt stress. The plant cell.

31(12), 3073-3091.

Tan, B., Yan, L., Li, H., Lian, X., Cheng, J., Wang, W.,

Zheng, X., Wang, X., Li, J., Ye, X. (2021). Genome-

wide identification of HSF family in peach and

functional analysis of PpHSF5 involvement in root

and aerial organ development. PeerJ. 9, e10961.

Tang, R., Gupta, S.K., Niu, S., Li, X.Q., Yang, Q., Chen,

G., Zhu, W., Haroon, M. (2020). Transcriptome

analysis of heat stress response genes in potato leaves.

Molecular biology reports. 47(6), 4311-4321.

Tian, F., Hu, X.L., Yao, T., Yang, X., Chen, J.G., Lu,

M.Z., Zhang, J. (2021). Recent advances in the roles

of HSFs and HSPs in heat stress response in woody

plants. Frontiers in plant science. 12, 704905.

Tian, X., Wang, F., Zhao, Y., Lan, T., Yu, K., Zhang, L.,

Qin, Z., Hu, Z., Yao, Y., Ni, Z. (2020). Heat shock

transcription factor A1b regulates heat tolerance in

wheat and Arabidopsis through OPR3 and jasmonate

signalling pathway. Plant biotechnology journal.

18(5), 1109-1111.

Wang, N., Liu, W., Yu, L., Guo, Z., Chen, Z., Jiang, S.,

Chen, X. (2020). HEAT SHOCK FACTOR A8a

modulates flavonoid synthesis and drought tolerance.

Plant Physiology. 184(3), 1273–1290.

Waterhouse, A., Bertoni, M., Bienert, S., Studer, G.,

Tauriello, G., Gumienny, R., Heer, F.T., Rempfer, C.,

Bordoli, L. (2018). SWISS-MODEL: homology

modelling of protein structures and complexes.

Nucleic acids research. 46(1), 296-303.

Yoshida, T., Ohama, N., Nakajima, J., Kidokoro, S.,

Mizoi, J., Nakashima, K., Maruyama, K., Kim, J.M.,

Seki, M., Todaka, D. (2011). Arabidopsis HsfA1

transcription factors function as the main positive

regulators in heat shock-responsive gene expression.

Molecular genetics and genomics. 286(5-6), 321-332.

ICBEB 2022 - The International Conference on Biomedical Engineering and Bioinformatics

282