Detection of Enterohemorrhagic Escherichia coli (EHEC) in

Consumption Water Source using Multiplex PCR Method

Khoirun Nihayati

, Yuanita Rachmawati

1*)

, Saiku Rokhim

, Linda Prasetyaning

Science & Technology Faculty, Universitas Islam Negeri Sunan Ampel, Surabaya, Indonesia

Psychology & Health Faculty, Universitas Islam Negeri Sunan Ampel, Surabaya, Indonesia

Keywords : Escherichia coli O157: H7, water consumption source, Multiplex PCR.

Abstract :

Escherichia coli is microorganism that often causes diarrhea. One of the most pathogenic E. coli bacteria for

humans is Escherichia coli O157: H7. These bacteria are included in E. coli Enterohemorrhagic (EHEC)

bacteria which produce shiga like toxin. Shiga like toxin causes Hemorrhagic Colitis (HC) and Hemolytic

Ureamic Syndrome (HUS). Water is a basic need for living things. Water that is suitable for use as a source

of consumption must fullfill certain chemical, physical and biological requirements. Biologically, the source

of consumption water should not contain E. coli. The presence of these bacteria indicates fecal contamination.

Water, especially consumption water, is a potential source for the spread of microorganisms that cause

infection, including E. coli O157: H7 bacteria. The purpose of this research is to detect Escherichia coli O157:

H7 bacteria in consumption water source sample using multiplex PCR method. The primers used in this study

were fliCh7 (625 bp), rfbE (296 bp), stx1 (210 bp), stx2 (484 bp), eaeA (397 bp), and hly (166 bp) genes. The

process of bacterial isolation was carried out through several stages, namely presumptive test, confirmed test,

and completed test. Isolation of bacterial DNA was carried out using boiling cell method. Amplification

process was carried out in conditions of 94˚C-2 minutes, followed by 35 cycles of 94˚C-20 seconds, 63˚C-1

minute annealing, and 72˚C-1 extension minutes, and post-extension 72˚C-10 minutes. Next, 2% agarose gel

electerophoresis was done at 50 volts for 65 minutes. The results showed that from the total 7 samples tested,

all are positive samples of coliform bacteria, 6 are positive samples of Escherichia coli bacteria, and 3 are

positive samples of Escherichia coli O157: H7 bacteria with virulent expression of different genes including

stx1 and eaeA genes. An analysis of all irrigation systems is needed to determine the entry of coliform

contamination, E. coli and E. coli O157: H7.

1. INTRODUCTION

Escherichia coli is a normal flora microorganism in

the human digestive tract and warm-blooded animals

that are facultative anaerobic (Drasar and Hill, 1974).

Based on its pathogenicity, E. coli is divided into 6

groups: Enteropathogenic E. coli (EPEC),

Enterotoxigenic E. coli (ETEC), Enterohemorrhagic

E. coli (EHEC), Enteroaggregative E. coli (EAEC),

Enteroinvasive E. coli (EIEC), and Diffusely

Sdherent E. coli (DAEC) (Nataro and Kaper, 1998).

Escherichia coli O157: H7 is part of the

Enterohemorrhagic E. coli group (EHEC) which is

the most pathogenic of other types due to its ability to

produce shiga like toxin which can cause Thrombotic

Thrombocytopenic Purpura (TTP), Hemorrhagic

Colitis, and Hemolytic Ureamic Syndrome (HUS)

(Law, 2000)

Water that is suitable for use as a source of

consumption must meet the requirements chemically,

physically, and biologically. Chemically,

consumption water must not contain toxic chemicals.

Physically, water should be odorless, tasteless and

colorless. Meanwhile, biologically, consumption

water should not contain E. coli bacteria. The

presence of these bacteria indicates that the water has

been contaminated by feces (Mubarak and Chayatin,

2009). Escherichia coli O157:H7 infections are

mostly caused by food or milk originating from

livestock, including fresh fruit, vegetables and water.

In America, the first incident reported

Escherichia coli O157:H7 infection after drinking

contaminated water occurred in 1989 in Missouri

Village. Food and water contamination has been

identified as a potential source of the spread of

pathogenicity of EHEC O157 in humans (Tutenel et

al., 2003). The Ministry of Health of the Republic of

Indonesia has urged the public to be aware of diseases

caused by E. coli bacteria. Because, according to the

Ministry of Health data, the outbreak of this disease

108

Nihayati, K., Rachmawati, Y., Rokhim, S. and Widayanti, L.

Detection of Enterohemorrhagic Escherichia coli (EHEC) in Consumption Water Source using Multiplex PCR Method.

DOI: 10.5220/0008907000002481

In Proceedings of the Built Environment, Science and Technology International Conference (BEST ICON 2018), pages 108-112

ISBN: 978-989-758-414-5

actually began to occur in Germany in mid-May

2011. Until June 2, 2011, Germany found 520 cases

of haemolytic uraemic syndrome (HUS) with 11

deaths. There were 1,213 cases of

enterohaemorrhagic Escherichia coli (EHEC); 6 of

them died. In Germany, there are 1,733 cases and 17

deaths (Zakki, 2015). Cases of E. coli O157:H7 cases

have been widely reported in developed countries

such as the United States and Japan, but there are few

data for cases that occur in Indonesia. This is due to

the unavailability of selective media for the isolation

of these pathogenic bacteria (Aziz et al., 2009). Hill

and Jinneman (2000) explained that, for the purpose

of epidemiological studies, a zoonotic agent should

be used in the application of genetic techniques

because the data produced have very high accuracy.

One of the molecular methods that can be used is the

multiplex PCR method. This method uses a variety of

primers to produce amplicons of various sizes

specific to different DNA sequences in one running-

test.

Multiplex Polymerase Chain Reaction is a type

of PCR technique that uses several primary pairs in

one reaction to produce amplicons from various target

genes with different DNA sizes. The use of molecular

techniques is done because it is specific to the target

genes to be detected. Besides that, the time used is

shorter compared to conventional testing. Therefore,

the purpose of this study is to detect the presence of

Escherichia coli O157: H7 bacteria in consumption

water sources samples using Multiplex PCR method.

2. RESEARCH METHODS

2.1. Tools and materials

The tools used in this study are Laminar Air Flow

(LAF), glass beaker, hot plate, ose needle, measuring

pipette, 10 µl micropipette, 20 μl, 200 μl, and 1000

μl, analytic balance sheet, centrifuge, autoclave,

incubator, water heater, thermocycler (Labnet),

spectrophotometer (Bio-Drop), electrophoresis

devices (Mupid-Exu), and gel documentation tool

(Enduro GDS-1302 Labnet).

The materials used in this study include 7

samples of consumption water, Lactose Broth (LB)

(Merck) media, Eosin Methylen Blue (EMB)

selective media (Merck), Nutrient Agar (NA) media (

Merck), sterile aquadest, Go Taq® Green mastermix,

six pairs of forward and reverse primary for multiplex

PCR detection including fliCh7 (flagellar antigen),

rbf E (antigen O157), stx 1 (shiga toxin 1), stx 2 (

shiga toxin 2), eaeA (intimin), and hly (haemolysin)

(Macrogen) (Table 1), agarose (Promega), DNA

scavengers Diamond Nucleic Acid Dye (Promega),

TAE Buffer solutions (Promega), loading dye

(Promega ), DNA Ladder 100 bp (Promega), isolates

of Escherichia coli O157: H7 bacteria as positive

controls obtained from the Veterinary Public Health

Laboratory of the Faculty of Veterinary Medicine,

Universitas Gadjah Mada of Yogyakarta, and isolates

Candida albicans as a negative control.

2.2. Sampling Method

The sampling process was carried out using purposive

sampling method. Total samples used in this study are

7 samples including tap water and ice cubes.

2.3. Presumptive Test

1 ml of water sample was inoculated into 9 ml Lactose

Broth (LB) media which was sterilized using

autoclave at 121

C for 15 minutes. Then, it was

incubated at 37° C for 24-48 hours. This process was

aimed at detecting the presence or absence of

coliform bacteria in a sample. Positive results of

coliform are indicated by changes in the color of the

media from cloudy to clear and gas appears on the

durham tube.

2.4. Confirmed Test

The testing process was carried out using Eosyn

Methylen Blue Agar (EMBA) media which is a

selective medium of E. coli bacteria. Positive results

on LB media were then inoculated on EMBA media

using needle ose, then incubated at 37° C for 24-48

hours. The positive results of E. coli bacteria are

marked by the appearance of a metallic green colony.

2.5. Completed Test

Purposed to multiply and purify E. coli bacteria

obtained from positive results in the confirmed test.

Performed using Nutrient Agar (NA) media which is

a universal medium for bacterial growth.

2.6. DNA Extraction

Isolation of bacterial DNA was carried out using

boiling cell method (BPOM Work Instructions,

2008). DNA isolates from NA media were taken as 2-

8 colonies using ose needles, then suspended with 500

µl sterile aquadest and distorted. The suspension

results were then roasted at a temperature of ± 100

for 15 minutes, then put into the freezer at ± -4

C for

Detection of Enterohemorrhagic Escherichia coli (EHEC) in Consumption Water Source using Multiplex PCR Method

109

3 minutes. After that, the suspension was centrifuged

at 12.000 rpm for 5 minutes. supernatant was taken as

much as 400 μl as a result of DNA isolates. The

results of DNA isolates were then measured in terms

of concentration and purity using a

spectrophotometer (Bio-Drop).

2.7. DNA Amplification

Amplification was done using the following 6

primary pairs as seen in Table 1. PCR reaction was

carried out on a total volume of 40 μl in each tube

consisting of 15 μl PCR Mastermix Solution, 9 µl

DNA Template, 12 primary pairs of 0.5 Primary

Primer and reverse µl, and 10 µl Free Water

Nuclease. Amplification was carried out using

Thermocycler with initial denaturation at 94˚C for 2

minutes, followed by 35 cycles of denaturation at

94˚C for 20 seconds, annealing at 63˚C for 1 minute,

and extension for 1 minute at 72˚ C, with the final

extension for 10 minutes at 72˚C ending with

maintenance at 4˚C.

2.8. Electrophoresis

Electrophoresis was carried out using 2% agarose gel

at 50 volts for 55 minutes

3. RESULTS AND DISCUSSION

The presumtive test results showed that of the total 7

samples tested; all of them were positive for coliform

bacteria, characterized by acid formation, indicated

by the color change of the media from clear to cloudy,

and gas appearing on the durham tube. This is due to

the ability of coliform group bacteria to ferment

lactose found in the growth media. Coliform bacteria

is one indicator of water quality. Coliform is found in

nature like soil, but consumption water is not a natural

environment for coliform bacteria (Sengupta and

Saha, 2013). Meanwhile, the results of the

connfirmed test showed that of the 7 samples tested,

6 samples were positive for E. coli bacteria and 1 was

negative. Positive results are indicated by the

appearance of a metallic green colony on EMBA

media while on the NA media, the colonies appeared

white as milk. The results of DNA isolates in this

study have a good value of purity and concentration,

it can be seen in the following table 2.

Table 1: Multiplex PCR Primer used in Amplification

Primers Sequences (5’-3’)

Target

gene

Amplicon

size (bp)

Reference

FLICH7-F GCGCTGTCGAGTTCTATCGAGC

fliCh7 625

Sarimehmetoglu et al., 2009

FLICH7-R CAACGGTGACTTTATCGCCATTCC

rfb E-F CAGGTGAAGGTGGAATGGTTGTC

rfb E 296

Bertrand et al., 2007

rfb E-R TTAGAATTGAGACCATCCAATAAG

SLT1-F TGTAACTGGAAAGGTGGAGTATACA

stx1 210

Sarimehmetoglu et al., 2009

SLT1-R GCTATTCTGAGTCAACGAAAAATAAC

SLT1 1-F GTTTTTCTTCGGTATCCTATTCC

stx2 484

Sarimehmetoglu et al., 2009

SLT1 1-R GATGCATCTCTGGTCATTGTATTAC

AE22 ATTACCATCCACACAGACGGT

eaeA 397

Sarimehmetoglu et al., 2009

AE20-2 ACAGCGTGGTTGGATCAACCT

MFS1-F ACGATGTGGTTTATTCTGGA

hly 166

Sarimehmetoglu et al., 2009

MFS1-R CTTCACGTCACCATACATAT

a b c

Figure 1. a. Presumptive Test result; b. Confirmed Test result; c. Completed Test result.

BEST ICON 2018 - Built Environment, Science and Technology International Conference 2018

110

Table 2. DNA Concentration and Purity

High purity DNA and free contaminants are

needed in molecular technology. The presence of

contaminants can inhibit the molecular testing

process. Generally contaminants found in DNA

isolates are in the form of enzymes, proteins, and

lipids (Padhye et al., 1997). DNA isolates are said

to be pure if the ratio value in Å260/280 is between

1.8 and 2.0. If the ratio value at Å260/280 is less

than 1.8, then DNA isolates are contaminated with

phenol or too much solvent is used, and the DNA

taken is too little. On the other hand, if the ratio

value at Å260/280 is more than 2.0, then DNA

isolates contain protein membrane contaminants or

other compounds (Sambrook and Ruslle, 2001).

Agarose gel electrophoresis results and

visualization using gel documentation showed the

following results:

Figure 2. Multiplex PCR results in sample S1-S7

M = Marker (DNA Ladder 100 bp); C+ = Positive

Control used E. coli O157:H7; C- = Negative

Control

The picture above shows that from the 6

samples tested, 3 positive samples expressed the

virulent gene of E. coli O157: H7 bacteria. Positive

samples include the S1 sample (ice cube 1) DNA

bands appear in the area of 210 bp and 397 bp which

is an area of amplification products from the stx1

and eaeA genes in sequence. Furthermore, in the S2

sample, bands appeared in the area of 210 bp

(positive for stx1 gene) and in the S5 sample, DNA

bands appeared in the area of 397 bp (positive for

eaeA gene).

E. coli O157: H7 is one of the most pathogenic

bacteria in humans because it has a variety of

different virulent genes, like a positive result in this

study which found a positive sample of the stx1

(shiga like toxin) gene resulting from the gene

expression which can inhibit protein synthesis

resulting in cell damage and death (Boerling et al.,

1999; Lahtia et al., 2001; Rey et al., 2006;

Bentancor et al., 2012). Meanwhile, the eaeA gene

encodes intimate proteins can cause adherence,

causing damage to the intestinal lining (Paton and

Paton, 1998; Boerling et al., 1999; Fu et al., 2005;

Rey et al., 2006). These bacteria should not be found

in consumption water. Water pollution caused by

microorganisms is an important problem that must

be addressed immediately (Sengupta and Saha,

2013) because water is a medium that is very

potential and fast in the spread of infectious

diseases. Therefore, it is necessary to evaluate and

monitor the consumption water (ice cubes) in

circulation so that infection by bacteria E. coli

O157: H7 can be prevented.

Multiplex PCR is one variation of the PCR

technique. This method uses several primary sets in

a single PCR mixture to produce amplicons of

various sizes specific to different DNA sequences.

With gene targeting at the same time, additional

information can be obtained from a single running

test that will not require multiple reagents and more

time to do it. Annealing temperature for each

primary set must be optimized to work correctly in

a single reaction, and amplicon size. That is, the

length of the base pair must be different enough to

form a different band when visualized by agarose

gel electrophoresis. Detection using multiplex PCR

is faster than using conventional culture methods

(microbiology) in sorbitol Mac Conkey agar

(SMAC) media, other than that PCR also eliminates

the possibility of errors in detecting the presence or

absence of Escherichia coli O157: H7 bacteria in a

sample because it uses a variety of primers specific

to a particular gene.

4. CONCLUSION

Based on the research that has been done, 7 are

positive samples of coliform bacteria, 6 are positive

samples of E. coli bacteria, and 3 are positive

samples of E. coli O157: H7 bacteria. Positive

samples of E. coli O157: H7 have different virulent

genes namely stx1 and eaeA.

Various ways can be done to prevent the

occurrence of infections due to these bacteria; one

Sample

Concentration

(μg/ml)

Å260

/280

Ice cube 1 S1 6.720 1.994

Ice cube 2 S2 3.474 1.716

Tap water 1 S3 2.033 1.795

Ice cube 3 S4 3.853 1.973

Tap water 2 S5 0.755 1.361

Tap water 3 S7 0.949 1.901

PositiveControl C+ 0.768 1.838

NegativeControl C - 0.536 2.269

Detection of Enterohemorrhagic Escherichia coli (EHEC) in Consumption Water Source using Multiplex PCR Method

111

of which is the correct and proper cooking process.

It is known that the toxin produced by EHEC

bacteria is damaged in the heating process with a

temperature of 100

C for 10 minutes, while the

EHEC bacteria themselves will die during the

heating process at 72

C for 10 minutes.

REFERENCES

Aziz, D. A., Marlina, & Yuherman. 2009.

Karakterisasi Gen Penghasil Toksin pada

Bakteri Patogen Escherichia Coli O157

dalam Rangka Penanggulangan Penyakit

Diare Berdarah pada Masyarakat. Artikel.

Universitas Andalas, Sumatera Barat.

Bentancor, A., Rumi, M. V., Carbonari, C.,

Gerhardt, E., Larza, M., Vilte, D. A., Creydt,

V. P., & Chinen, I. 2012. Profile of Shiga

toxin-producing Escherichia coli strains

isolated from dogs and cats and genetic

relationships with isolates from cattle, meat

and humans. Vet Microbiol. 156: 336–342.

Boerling, P., Mc Ewen, S. A., Wilson, J. B.,

Johnson, R. P. & Gyles, C. L. 1999.

Association between virulence factors of

shiga toxin-producing Escherichia coli and

disease in humans. Journal of Clinical

Microbiology 37: 497–503.

Boerling, P., Mc Ewen, S. A., Wilson, J. B.,

Johnson, R. P. & Gyles, C. L. 1999.

Association between virulence factors of

shiga toxin-producing Escherichia coli and

disease in humans. Journal of Clinical

Microbiology 37: 497–503.

Drasar, B. S. & Hill, M. J. 1974. Human Intestinal

Flora. Academic Press Ltd, London.

Fu, Z., Rogelj, S. & Kieft, T. L. 2005. Rapid

detection of Escherichia coli O157:H7 by

immunomagnetic separation and real-time

PCR. Int J Food Microbiol. 99: 47–57.

Hill, W. E., & Jinneman, K. C. 2000. Principles and

Application of Genetic Techniques for

Detection, Identification, and subtyping of

Food-Associated Pathogenic

Microorganism in The Microbiological

Safety and Quality of Food. Vol. II (ed)

Barbara ML, Baird- Parker TC, Gould GW.

Maryland Aspen Publishers, Inc,

Gaithersburg.

Instruksi Kerja BPOM. 2008. Info POM. Badan

Pengawas Obat dan Makanan Republik

Indonesia. Vol. 9, No. 2

Jeshveen, S. S., Chai, L. C., Pui, C. F. & Son, R.

2012. Optimization of multiplex PCR

conditions for rapid detection of Escherichia

coli O157:H7 virulence genes. International

Food Research Journal 19(2): 461-466.

Lahtia, E., Keskimaeki, M., Rantala, L., Hyvoenen,

P., Siitonen, A. & Honkanen-Buzalski, T.

2001. Occurrence of Escherichia coli O157

in Finnish cattle. Vet Microbiol. 79:239–251.

Law, D. 2000. Virulence factors of Escherichia

coli O157 and other shiga toxin producing

E. coli . Journal of Applied Microbiology

88: 729-745.

Mubarak, W. I., & Chayatin, N. 2009. Ilmu

Kesehatan Masyarakat Teori dan Aplikasi.

Salemba Medika, Jakarta.

Nataro, J. P. & Kaper, J. B. 1998. Diarrheagenic

Escherichia coli. Clinical Microbiology

Review 11: 142-201.

Padhye, V. V., York, C., & Burkiewicz, A. 1997.

Nucleic Acid Purification On Silica Gel and

Glass Mixtures. US Patent 5658548 CI.

Paton, A.W. & Paton, J.C. 1998. Detection and

characterization of Shiga Toxigenic

Escherichia coli by using Multiplex PCR

Assays for stx1, stx2, eaeA,

Enterohemorrhagic E. coli hlyA, rfbO111,

and rfbO157. J Clin Microbiol. 36: 598–602.

Rey, J., Sa′nchez, S., Blanco, J. E., Hermoso de

Mendoza, J., Hermoso de Mendoza, M.,

Garcı′a, A., Gil, C., & Tejero, N. 2006.

Prevalence, serotypes and virulence genes of

Shiga toxin-producing Escherichia coli

isolated from ovine and caprine milk and

other dairy products in Spain. Int J Food

Microbiol. 107: 212–217.

Sambrook, J. & David W. Rusell. 2001. Molecular

Cloning: A Laboratory Manual. 3

ed. Cold

Spring Harbor Laboratory Press.

Sengupta, C. & Rita S. 2013. Review Article:

Understanding Coliforms-A Short Review.

International Journal of Advance Research.

1: 16-25.

Tutenel, A., Pierard, D., Jan, V.H., & L. D Zutteri.

2003. Molecular Characterization of

Escherichia coli O157:H7 Contamination

routes in a Cattle Slaughterhouse. Journal of

Food Protection. 66(9): 1564-1569.

Zakki, G. H. 2015. Pengetahuan dan Perilaku

Preventif Terhadap Bakteri E. coli pada

Masyarakat Kecamatan Gondomanan di

Kota Yogyakarta. Skripsi. Fakultas Ilmu

Pendidikan, Universitas Negeri Semarang,

Semarang.

BEST ICON 2018 - Built Environment, Science and Technology International Conference 2018

112