Effects of Herbal Ingredients (Allium sativum, Punica granatum,

Curcuma longa, Curcuma xanthorrhiza) on FATP3 Gene Expression

in Aorta of High Fat Diet-fed Rats: A Preliminary Study

Diana Krisanti Jasaputra

1,2 a

, Julia Windi Gunadi

2,3 b

, Penny Setyawati Martioso

, Larissa

Yenny Noor

, Irna Permanasari Gani

, Erik Dwikurnia Saiman

, Desman Situmorang

and Andi Haryanto

Department of Pharmacology, Faculty of Medicine, Maranatha Christian University, Jl. Suria Sumantri, Bandung,

Indonesia

Maranatha Biomedical Research Laboratory, Maranatha Christian University, Jl. Suria Sumantri, Bandung, Indonesia

Department of Physiology, Faculty of Medicine, Maranatha Christian University, Jl. Suria Sumantri, Bandung, Indonesia

Department of Clinical Pathology, Faculty of Medicine, Maranatha Christian University, Jl. Suria Sumantri, Bandung,

Indonesia

Department of Ophthalmology, Faculty of Medicine, Maranatha Christian University, Jl. Suria Sumantri, Bandung,

Indonesia

Department of Psychiatry, Faculty of Medicine, Maranatha Christian University, Jl. Suria Sumantri, Bandung, Indonesia

Department of Obstetric Gynecology, Faculty of Medicine, Maranatha Christian University, Jl. Suria Sumantri, Bandung,

Indonesia

Department of Obstetric Gynecology, Faculty of Medicine, Maranatha Christian University, Jl. Suria Sumantri, Bandung,

Indonesia

Department of Internal Medicine, Faculty of Medicine, Maranatha Christian University, Jl. Suria Sumantri, Bandung,

Indonesia

yennynoor@yahoo.com, Irna_genie@yahoo.com, eriksaiman72@gmail.com, dman2912@gmail.com,

andi_agape@yahoo.com

Keywords: Curcuma, Allium Sativum, Punica Granatum, FATP3.

Abstract : FATP (Fatty Acid Transport Protein) is a protein that facilitates uptake of LCFA (Long Chain Fatty Acid) by

activating it into CoA-thioester and trapping them in the cell. FATP3 is critical for LCFA uptake in endothelial

cells. Herbal ingredients are well known as anti-hyperlipidemic and anti-atherosclerotic agents, but the

molecular mechanism for these effects are still unclear. Twenty-eight male Wistar rats used in this study were

divided into negative control, positive control (HFD), and treatments (175 mg/kg BW Allium sativum, Punica

granatum, Curcuma longa, Curcuma xanthorrhiza, and 1.8 mg/kg BW Rosuvastatin), each group consisted

of 4 rats. The rats were given vitamin D 700.000 mg/kg BW single dose to all groups except for negative

control, continued with HFD combined with herbal ingredients for twelve weeks. After treatments, the rats

were sacrificed, RNA was extracted from the aorta to perform semi-quantitative PCR (FATP3 and GAPDH).

We found no significant differences in FATP3 gene expression between all groups. In summary, herbal

ingredients (Allium sativum, Punica granatum, Curcuma longa, Curcuma xanthorrhiza) do not influence

FATP3 gene expression in the aorta of high fat diet-fed rats.

1 INTRODUCTION

Population around the world has been through a

modern transition, where the trends of a sedentary

https://orcid.org/0000-0001-5608-6112

https://orcid.org/0000-0003-3645-7486

lifestyle and over calories become more prominent

than under-nutrition (Shao et al., 2017). This

transition might lead to obesity that served as a risk

factor for developing metabolic syndrome, thus

328

Jasaputra, D., Gunadi, J., Mar tioso, P., Larissa, ., Noor, Y., Gani, I., Saiman, E., Situmorang, D. and Haryanto, A.

Effects of Herbal Ingredients (Allium sativum, Punica granatum, Curcuma longa, Curcuma xanthorrhiza) on FATP3 Gene Expression in Aorta of High Fat Diet-fed Rats: A Preliminary Study.

DOI: 10.5220/0010753800003113

In Proceedings of the 1st International Conference on Emerging Issues in Technology, Engineering and Science (ICE-TES 2021), pages 328-332

ISBN: 978-989-758-601-9

increasing the risk for atherosclerosis (Aboonabi,

Meyer, & Singh, 2019). Recent research has shown

that metabolic syndrome promotes atherosclerotic

lesions, and endothelium might mediate some of the

effects (Aboonabi et al., 2019; Goldberg & Bornfeldt,

2013). The main risk factor for developing obesity

that might contribute to the incidence of

atherosclerosis is dietary fat intake (Csige et al.,

2018). The previous study has shown that dietary

intake of Long Chain Fatty Acid (FATP) in large

amounts might induce lesions of atherosclerosis

(Blair, Sepulveda, & Papachristou, 2016).

LCFA, mostly found in our dietary lipid intake,

require active transport into the blood flow (Dallinga-

Thie et al., 2010). FATP (Fatty Acid Transport

Protein), a family of transmembrane proteins, has

been proven to improve LCFA cellular uptake (C.

Hagberg, Mehlem, Falkevall, Muhl, & Eriksson,

2013; Stahl, Gimeno, Tartaglia, & Lodish, 2001).

FATP has 6 members, ranging from FATP1 until

FATP6, that could be found in many organs utilizing

fatty acid (Stahl et al., 2001). FATP3 is expressed in

endothelial cells including aorta and works

synergically with FATP4 to induce LCFA uptake (C.

E. Hagberg et al., 2010). Abnormal LCFA influx into

skeletal muscle, heart, the liver might lead to insulin

resistance, oxidative stress, and eventually apoptosis,

therefore it is important to study the mechanism of

LCFA uptake by FATP to identify potential therapy

for a metabolic disease that might lead to

atherosclerosis (Aboonabi et al., 2019; Anderson &

Stahl, 2013; Kazantzis & Stahl, 2012).

Herbal ingredients, such as Allium sativum,

Punica granatum, and Curcumin has been known for

having the effect of anti-atherosclerosis (Koscielny et

al., 1999; Majeed, Ghafil, Fatima, Hadi, & Mahdi,

2021; Supekar & Kale, 2015). Low-dose curcumin

reduce atherogenesis in a mouse model of human

atherosclerosis through the suppression of CD36 (a

FATP) in macrophages (Hasan et al., 2014). Allium

sativum inhibited the thickening of neointimal in

rabbits given high cholesterol diet, and in cell culture

treated with atherosclerosis patient’s serum, reduced

atherogenic potential was shown (Sobenin et al.,

2016; Sobenin, Myasoedova, Iltchuk, Zhang, &

Orekhov, 2019). Punica granatum reduced the

progression of atherosclerosis in

hypercholesterolemic mice (de Nigris et al., 2007). A

clinical trial of Curcuma longa in patients at risk of

CVD showed evidence of Curcuma xanthorrhiza

beneficial effects on serum TG and LDL-C levels

(Qin et al., 2017). The study of Curcuma

xanthorrhiza has proven that C. xanthorrhiza

decreased LDL-Cholesterol level and Total-

Cholesterol level, and increased HDL-Cholesterol

level in dyslipidemic Sprague Dawley rats (Budiarto

et al., 2017). Although many kinds of research have

proven the anti-hyperlipidemic and anti-

atherosclerotic effect of these herbal ingredients, little

is known about the detailed molecular mechanism

involving FATP3 in the aorta.

In the present study, we want to elaborate on the

effect of herbal ingredients in the aorta of high-fat

diet-fed rats. According to previous study,

atherosclerosis could be induced by vitamin D3 single

dose and three months of high lipid diets in rats (Pang

et al., 2010). Therefore, in this study, we aim to know

whether a high-fat diet would influence FATP3 in the

aorta of Wistar rats after supplementation of herbal

ingredients (Allium sativum, Punica granatum,

Curcuma longa, and Curcuma xanthorrhiza).

2 METHODS (AND MATERIALS)

2.1 Animals

Twenty-eight male Wistar rats, aged 8 weeks, weight

200-220 grams, were divided into seven groups

(negative control, positive control, A. sativum, P.

granatum, C. longa, C.xanthorrhiza, and

Rosuvastatin). The rats were put in a cage per group

and given a high-fat diet. The temperature was

maintained between 22-24°C each day and light-dark

cycle every 12 hours. The rats were environmentally

habituated for 1 week, continued with vitamin D3

700.000 mg/kg BW orally single dose, then high-fat

diet for 12 consecutive weeks, except the negative

control group that was given standard chow diet

(Pang et al., 2010). The treatment was given for 12

weeks and there was 175 mg/kg BW of A. sativum, P.

granatum, C. longa, C. xanthorrhiza ethanol extract,

and 1.8 mg/kgB Rosuvastatin. On the final day of

treatments, rats were terminated, and aorta was taken,

then stored in a -80°C refrigerator until further use for

RNA extraction and PCR.

All procedures were conducted according to the

use and care of laboratory animal guidelines

(Committee for the Update of the Guide for the Care

and Use of Laboratory Animals, Institute for

Laboratory Animal Research, Division on Earth and

Life Studies, 2011). Ethical approval was obtained

from the Faculty of Medicine’s Research Ethics

Committee in Universitas Kristen Maranatha-Rumah

Sakit Immanuel Bandung with the number

160/KEP/XI/2020.

Effects of Herbal Ingredients (Allium sativum, Punica granatum, Curcuma longa, Curcuma xanthorrhiza) on FATP3 Gene Expression in

Aorta of High Fat Diet-fed Rats: A Preliminary Study

329

2.2 RNA Extraction and

Semi-quantitative PCR

We conducted extraction of RNA from stored aorta

using Trisure reagent, with the proportion of 200 ul

Trisure per 10-20 mg sample (BIO-38033, Bioline,

London). After measuring the purity and

concentration of the extracted RNA using 260/280 nm

absorbance spectrophotometry (51119300, Multiskan

Go Microplate Spectrophotometer, Thermo,

Netherland), we conducted semi-quantitative PCR

using One-Step RT PCR Kit (BIO-65409, Bioline,

London). We used GAPDH as the housekeeping gene.

After PCR, we continued with electrophoresis, then

visualization of the gels using Bluepad, and image

quantification using Image J. Primer sequences used

in this study were as follows: for FATP3:

Fwd 5’- CTGGGACGAGCTAGAGGAAG -3’,

Rev 5’- GCTGAGGCCAGAGGTCTAAC -3’

(Lee et al., 2017)

GAPDH:

Fwd 5’- GTTACCAGGGCTGCCTTCTC-3’,

Rev 5’- GATGGTGATGGGTTTCCCGT-3’

(Wang et al., 2017).

2.3 Statistical Analysis

The result of the study (relative ratio of gene

expression) is presented as mean ± SEM. Statistical

analysis was done using SPSS 26.0 statistical

software (IBM, United States). ANOVA continued

with LSD post hoc analysis was used for testing the

difference between the groups, and p<0.05 is

considered as significant.

3 RESULTS AND DISCUSSION

We presented the result One Way Anova analysis for

the mean relative ratio of FATP3 gene expression

normalized by GAPDH in table 1 below.

Table 1: One Way Anova of FATP3 Gene Expression in

Aorta of Wistar Rats.

Groups

FATP3

Relative

Ratio ± SEM

N F p

Negative control 0.88 ± 0.06 4

1.524 0,219

Positive control

0.74 ± 0.07 4

llium sativum

0.97 ± 0.06 4

Punica granatum

0.89 ± 0.04 4

Curcuma longa

1.01 ± 0.07 4

Rosuvastatin

1.02 ± 0.09 4

Curcuma xanthorrhiza

0.97 ± 0.07 4

The result of

semi-quantitative PCR and the graphical

result of the study is presented in figure 1 below

Figure 1: A. FATP3 and GAPDH Gene Expression from

Aorta of High Fat Diet-fed Rats; B. Relative Ratio of

FATP3 Gene Expression from Aorta of High Fat Diet-fed

Rats. (-) = Negative control, (+) = Positive control, AS =

Allium sativum, PG = Punica granatum, CL = Curcuma

longa, R = Rosuvastatin, CS = Curcuma xanthorrhiza

Protein-mediated transport active has been proven

to be the major route for the entering of LCFA into

the cells. Therefore, a comprehensive understanding

of FATPs would guide the possibility of making them

a promising target therapy for treating metabolic

diseases (Glatz, Luiken, & Bonen, 2010). FATP3 and

FATP4 are endothelial fatty acid transport, both

required for effective LCFA transport through the

barrier of the vascular endothelium (C. Hagberg et al.,

2013). Research showed that a high-fat diet induces

an increase of FATP1 in soleus muscle, but a decrease

in gastrocnemius muscles and this contrary effect

might be caused by different fiber types correlated

with distinct PPAR gamma sensitivity (Marotta et al.,

2004). In the intestine of humans, FATP4 is

upregulated after 3 days of a high-fat diet (Tremblay

et al., 2013). But research about the effect of a high-

fat diet on FATP3 gene expression is still limited.

In this study, we found no significant difference

in FATP3 gene expression between groups (figure 1).

This is a preliminary study that aims to investigate

whether FATP3 in the aorta might change after given

a high-fat diet and vitamin D3 that might induce

atherosclerosis and after supplementation of herbal

ingredients. This result might show that a high-fat diet

and herbal ingredients might not influence FATP3

gene expression in the aorta, but there is a tendency

ICE-TES 2021 - International Conference on Emerging Issues in Technology, Engineering, and Science

330

of increase of FATP3 gene expression in treatment

groups compared to control. This tendency to

increase might show increased activity of FATP3 on

LCFA uptake as compensation to prevent lipid

deposition in non-adipose tissue. While in the

positive control, high fat diet and vitamin D3 that

potentially induce atherosclerosis decrease FATP3

gene expression. We hypothesize this effect (table 1)

may occur because of endothelial dysfunction that

might potentially found in early atherosclerosis

(Gimbrone Jr & García-Cardeña, 2016), but further

investigation needs to be conducted to support this

hypothesis.

The limitation of this study is: (1) time duration of

HFD

and vitamin D3 induce atherosclerosis might be

too short, therefore we suggest a longer time duration

to achieve a better perspective of the molecular

mechanism behind fatty acid transport protein

alteration in aorta after supplementation of herbal

ingredients; (2) herbal ingredients formulation might

not be appropriate and need to be adjusted for better

result of the experiments; (3) microscopic evaluation

to confirm atherosclerosis, such as Weigert and van

Kossa staining (Pang et al., 2010) is not provided in

this study.

4 CONCLUSIONS

In summary, herbal ingredients (Allium sativum,

Punica granatum, Curcuma longa, and Curcuma

xanthorrhiza) do not influence FATP3 gene

expression in the aorta of high-fat diet-fed Wistar rats.

Further study needs to be conducted to investigate the

detailed mechanism of LCFA transport change in

hyperlipidemia states and the role of herbal

ingredients as anti-atherosclerotic agents.

ACKNOWLEDGEMENTS

We would like to thank Nenden, dr Ardo, Demes for

the technical assistance for molecular procedures.

And we also would like to thank dr. Ronny, dr.

Hanna, Azis, Pak Nana, Pak Kris for their assistance

in studying the Wistar rats.

REFERENCES

Aboonabi, A., Meyer, R. R., & Singh, I. (2019). The

association between metabolic syndrome components

and the development of atherosclerosis. Journal of

Human Hypertension, 33(12), 844–855.

https://doi.org/10.1038/s41371-019-0273-0

Anderson, C. M., & Stahl, A. (2013). SLC27 fatty acid

transport proteins. Molecular Aspects of Medicine,

34(2–3), 516–528.

https://doi.org/10.1016/j.mam.2012.07.010

Blair, H. C., Sepulveda, J., & Papachristou, D. J. (2016).

Nature and nurture in atherosclerosis: The roles of

acylcarnitine and cell membrane-fatty acid

intermediates. Vascular Pharmacology, 78, 17–23.

https://doi.org/10.1016/j.vph.2015.06.012

Budiarto, A., Wibowo, A., Putri, S., Shabrina, N.,

Ngestiningsih, D., & Tjahjono, K. (2017). Pengaruh

Pemberian Ekstrak Rimpang Temulawak (Curcuma

Xanthorrhiza Roxb.) dan Jintan Hitam (Nigella Sativa)

terhadap Profil Lipid Tikus Sprague Dawley

Dislipidemia. Majalah Kedokteran Bandung, 47, 8–14.

https://doi.org/10.15395/mkb.v47n1.982

Committee for the Update of the Guide for the Care and Use

of Laboratory Animals, Institute for Laboratory Animal

Research, Division on Earth and Life Studies, & N. R.

C. (2011). Guide for the care and use of laboratory

animals (8th ed.). Washington (DC).

https://doi.org/10.17226/12910

Csige, I., Ujvárosy, D., Szabó, Z., Lőrincz, I., Paragh, G.,

Harangi, M., & Somodi, S. (2018). The Impact of

Obesity on the Cardiovascular System. Journal of

Diabetes Research, 2018, 3407306.

https://doi.org/10.1155/2018/3407306

Dallinga-Thie, G. M., Franssen, R., Mooij, H. L., Visser,

M. E., Hassing, H. C., Peelman, F., … Nieuwdorp, M.

(2010). The metabolism of triglyceride-rich

lipoproteins revisited: new players, new insight.

Atherosclerosis, 211(1), 1–8.

https://doi.org/10.1016/j.atherosclerosis.2009.12.027

de Nigris, F., Williams-Ignarro, S., Sica, V., Lerman, L. O.,

D’Armiento, F. P., Byrns, R. E., … Napoli, C. (2007).

Effects of a pomegranate fruit extract rich in

punicalagin on oxidation-sensitive genes and eNOS

activity at sites of perturbed shear stress and

atherogenesis. Cardiovascular Research, 73(2), 414–

423. https://doi.org/10.1016/j.cardiores.2006.08.021

Gimbrone Jr, M. A., & García-Cardeña, G. (2016).

Endothelial Cell Dysfunction and the Pathobiology of

Atherosclerosis. Circulation Research, 118(4), 620–

636.

https://doi.org/10.1161/CIRCRESAHA.115.306301

Glatz, J. F. C., Luiken, J. J. F. P., & Bonen, A. (2010).

Membrane fatty acid transporters as regulators of lipid

metabolism: implications for metabolic disease.

Physiological Reviews, 90(1), 367–417.

https://doi.org/10.1152/physrev.00003.2009

Goldberg, I. J., & Bornfeldt, K. E. (2013). Lipids and the

endothelium: bidirectional interactions. Current

Atherosclerosis Reports, 15

(11), 365.

https://doi.org/10.1007/s11883-013-0365-1

Hagberg, C. E., Falkevall, A., Wang, X., Larsson, E.,

Huusko, J., Nilsson, I., … Eriksson, U. (2010).

Vascular endothelial growth factor B controls

Effects of Herbal Ingredients (Allium sativum, Punica granatum, Curcuma longa, Curcuma xanthorrhiza) on FATP3 Gene Expression in

Aorta of High Fat Diet-fed Rats: A Preliminary Study

331

endothelial fatty acid uptake. Nature, 464(7290), 917–

921. https://doi.org/10.1038/nature08945

Hagberg, C., Mehlem, A., Falkevall, A., Muhl, L., &

Eriksson, U. (2013). Endothelial fatty acid transport:

role of vascular endothelial growth factor B. Physiology

(Bethesda, Md.), 28(2), 125–134.

https://doi.org/10.1152/physiol.00042.2012

Hasan, S. T., Zingg, J.-M., Kwan, P., Noble, T., Smith, D.,

& Meydani, M. (2014). Curcumin modulation of high

fat diet-induced atherosclerosis and steatohepatosis in

LDL receptor deficient mice. Atherosclerosis, 232(1),

40–51.

https://doi.org/10.1016/j.atherosclerosis.2013.10.016

Kazantzis, M., & Stahl, A. (2012). Fatty acid transport

proteins, implications in physiology and disease.

Biochimica et Biophysica Acta, 1821(5), 852–857.

https://doi.org/10.1016/j.bbalip.2011.09.010

Koscielny, J., Klüssendorf, D., Latza, R., Schmitt, R.,

Radtke, H., Siegel, G., & Kiesewetter, H. (1999). The

antiatherosclerotic effect of Allium sativum.

Atherosclerosis, 144(1), 237–249.

https://doi.org/10.1016/s0021-9150(99)00060-x

Lee, Y. Bin, Choi, J. H., Kim, E. N., Seok, J., Lee, H.-J.,

Yoon, J.-H., & Kim, G. J. (2017). Human Chorionic

Plate-Derived Mesenchymal Stem Cells Restore

Hepatic Lipid Metabolism in a Rat Model of Bile Duct

Ligation. Stem Cells International, 2017, 5180579.

https://doi.org/10.1155/2017/5180579

Majeed, M. L., Ghafil, F. A., Fatima, G., Hadi, N. R., &

Mahdi, H. F. (2021). Anti-Atherosclerotic and Anti-

Inflammatory Effects of Curcumin on

Hypercholesterolemic Male Rabbits. Indian Journal of

Clinical Biochemistry, 36(1), 74–80.

https://doi.org/10.1007/s12291-019-00858-5

Marotta, M., Ferrer-Martnez, A., Parnau, J., Turini, M.,

Macé, K., & Gómez Foix, A. M. (2004). Fiber type- and

fatty acid composition-dependent effects of high-fat

diets on rat muscle triacylglyceride and fatty acid

transporter protein-1 content. Metabolism: Clinical and

Experimental, 53(8), 1032–1036.

https://doi.org/10.1016/j.metabol.2004.03.011

Pang, J., Xu, Q., Xu, X., Yin, H., Xu, R., Guo, S., … Cao,

J.-M. (2010). Hexarelin suppresses high lipid diet and

vitamin D3-induced atherosclerosis in the rat. Peptides,

31(4), 630–638.

https://doi.org/10.1016/j.peptides.2009.11.007

Qin, S., Huang, L., Gong, J., Shen, S., Huang, J., Ren, H.,

& Hu, H. (2017). Efficacy and safety of turmeric and

curcumin in lowering blood lipid levels in patients with

cardiovascular risk factors: a meta-analysis of

randomized controlled trials. Nutrition Journal, 16(1),

68. https://doi.org/10.1186/s12937-017-0293-y

Shao, A., Drewnowski, A., Willcox, D. C., Krämer, L.,

Lausted, C., Eggersdorfer, M., … Griffiths, J. C.

(2017). Optimal nutrition and the ever-changing dietary

landscape: a conference report. European Journal of

Nutrition, 56

(1), 1–21. https://doi.org/10.1007/s00394-

017-1460-9

Sobenin, I. A., Andrianova, I. V, Lakunin, K. Y.,

Karagodin, V. P., Bobryshev, Y. V, & Orekhov, A. N.

(2016). Anti-atherosclerotic effects of garlic

preparation in freeze injury model of atherosclerosis in

cholesterol-fed rabbits. Phytomedicine : International

Journal of Phytotherapy and Phytopharmacology,

23(11), 1235–1239.

https://doi.org/10.1016/j.phymed.2015.10.014

Sobenin, I. A., Myasoedova, V. A., Iltchuk, M. I., Zhang,

D.-W., & Orekhov, A. N. (2019). Therapeutic effects of

garlic in cardiovascular atherosclerotic disease.

Chinese Journal of Natural Medicines, 17(10), 721–

728. https://doi.org/10.1016/S1875-5364(19)30088-3

Stahl, A., Gimeno, R. E., Tartaglia, L. A., & Lodish, H. F.

(2001). Fatty acid transport proteins: a current view of

a growing family. Trends in Endocrinology and

Metabolism: TEM, 12(6), 266–273.

https://doi.org/10.1016/s1043-2760(01)00427-1

Supekar, A. R., & Kale, A. J. (2015). Anti-Atherosclerosis

Activity of Seed oil of Punica Granatum Linn in Triton

X-100 induced hyperlipidemic rats. International

Journal of Advanced Research, 3, 1276–1280.

Retrieved from https://www.journalijar.com/article/

6105/anti-atherosclerosis-activity-of-seed-oil-of-

punica-granatum-linn-in-triton-x-100-induced-

hyperlipidemic-rats/

Tremblay, A. J., Lamarche, B., Guay, V., Charest, A.,

Lemelin, V., & Couture, P. (2013). Short-term, high-fat

diet increases the expression of key intestinal genes

involved in lipoprotein metabolism in healthy men. The

American Journal of Clinical Nutrition, 98(1), 32–41.

https://doi.org/10.3945/ajcn.113.060251

Wang, K., Wang, F., Bao, J.-P., Xie, Z.-Y., Chen, L., Zhou,

B.-Y., … Wu, X.-T. (2017). Tumor necrosis factor α

modulates sodium-activated potassium channel SLICK

in rat dorsal horn neurons via p38 MAPK activation

pathway. Journal of Pain Research, 10, 1265–1271.

https://doi.org/10.2147/JPR.S132185

ICE-TES 2021 - International Conference on Emerging Issues in Technology, Engineering, and Science

332