Gene Editing of Saccharomyces Cerevisiae Using CRISPR

Chenyu Yang

1,*

and Yilin Li

Queen Mary College, Nanchang University, the Medical College, Block C, No. 999, Xuefu Avenue, Honggutan New

District, Nanchang, China

Biomedical Science Department, Southern University of Science and Technology, No. 1088, Xueyuan Avenue, Nanshan

District, Shenzhen, China

Keywords: CRISPR Cas9, PCR’ Gene Editing, Fluorescent Protein Gene.

Abstract: This experiment aims to integrate the mCherry gene into saccharomyces cerevisiae (S.cerevisiae) genome and

examine its expression in S.cerevisiae. This experiment is to detect whether the integration and mCherry gene

expression are successful. By applying the CRISPR/Cas9 and PCR techniques, we have shown that the

integration into S. cerevisiae is successful, and the mCherry gene is expressed perfectly. This experiment

shows the feasibility of the CRISPR/Cas9 technique, which can be applied in clinical treatments or mass

production of certain medical products.

1 INTRODUCTION

CRISPR/Cas9 is a mechanism of gene editing,

applied to form guide RNA (gRNA) plasmids and

integrate target gene into cells, in order to express the

target gene (L.S.Q, 2013).

CRISPR/Cas9 is categorized into two types: Non-

Homologous End Joining (NHEJ) and Homology

Directed Repair (HDR). NHEJ is a pathway that

repairs double-strand break mutations by insertions or

deletions, before knocking out the gene. HDR repairs

the template to complete gene editing.

The technique has the potential to affect scientific

research. It enables more precise gene editing, a

higher probability of successful transformation and a

purer transformation product. This technique

supports experts to express certain DNA and obtain

the target substances (Yan, 2022). CRISPR/Cas9 is a

perfect tool to transform cells, making them produce

certain substances, which can also be applied in

medical treatments, mass production of certain

medical products, and so on.

CRISPR/Cas9 employs the Cas9 Nickases from

BJ5464-p414-Cas9 as a catalyst. The gRNA binds

with and cuts the target sequence, which is the pre-

designed target gene (Wu, 2014). In this experiment,

the binding happens with the plasmids and transforms

the S.cerevisiae. The advantage of CRISPR/Cas9 is

its high efficiency, which increases its ability to

modify the gene accurately and efficiently. Nucleic

acid probe-based qPCR identifies the mutation site

rapidly. It can be used for genotyping to the

subsequent formation of a colony (

Vasu, 2021)

CRISPR/Cas9 is more accurate than the double

enzyme digestion technique, and it provides blunt

ends, which means the sequence cut by CRISPR/Cas9

will be less possible to adhere to other sequences. The

sequence cut by the technique is more likely to be

pure target fragments. The difficulty in purifying and

detecting the aim proteins (the expression of the

target gene) will decrease. However, as a pre-mature

technique, CRISPR/Cas9 still needs to be optimized.

The experiment aims to use S.cerevisiae to

express the fluorescent protein gene by the

CRISPR/Cas9 technology. The exogenous

expression box (YPet fluorescent protein) has already

been structured. In this experiment, we have activated

the S. cerevisiae BJ5464/ p414-TEF1p-Cas9-CYC1t

culture and made the competent cells to gain S.

cerevisiae host bacteria.

2 MATERIALS AND METHODS

2.1 Materials

S. cerevisiae BJ5464/ p414- TEF1p- Cas9- CYC1t,

E.coli.

PCR centrifuge tubes, 1.5ml centrifuge tubes.

PCR Machine, electrophoresis apparatus.

404

Yang, C. and Li, Y.

Gene Editing of Saccharomyces Cerevisiae Using CRISPR.

DOI: 10.5220/0012021800003633

In Proceedings of the 4th International Conference on Biotechnology and Biomedicine (ICBB 2022), pages 404-409

ISBN: 978-989-758-637-8

 2023 by SCITEPRESS – Science and Technology Publications, Lda. Under CC license (CC BY-NC-ND 4.0)

2.2 Methods

2.2.1 Design of gRNA Plasmids

Design the gRNA sequence to participate in the

reaction with the plasmids in the experiment. Anneal

the primer, bind the gRNA with the enzyme carrier

(p426- pSNR-gRNA- tSUP4) of E. coli, let the

transformed plasmids proliferate in the E. coli, and

then extract the plasmids.

1) Guide sequences

LEU- sgRNA target sequence:

TTTGTTGCCATCTGCGTCCT;

LEU- sgRNA- F: 5’ -

GATCTTTGTTGCCATCTGCGTCCTG- 3’;

LEU- sgRNA- R: 5’ -

AAAACAGGACGCAGATGGCAACAAA- 3’.

2) Primer annealing

Suspend the forward and reverse oligo in 100uM

HEPES (pH= 7.9) water.

3) Connection

Dilute the tenfold annealed double strands DNA

(0.1μL)

T4 DNA Ligase (0.25μL)

Buffer (0.5 μL)

Carrier (0.5 μL)

Up to 5 μL

Reaction conditions: 16℃, overnight.

4) E. coli transformation

Remove the competent cells (100μL) out from a

fridge at -80℃ and place them on ice for about 30

min. Add 10μL connection products and mix them,

and place them on ice for about 30 min.

Heat the competent cells with the connection

products in a water bath for 90 s, then place them on

ice for 2 min immediately. Add the competent cells

into 800μL LB medium without screening resistance

(preheated to 37℃), cultivate at 37℃, at a 180-rpm

table for about 1h.

Centrifuge the cells (at 300 rpm) for 3 min,

discard 600μL supernatant, resuspend the rest of the

thalli and transfer 200μL liquid smear to the

ampicillin-resistance LB solid tablet. Cultivate at

37℃ for about 20-22h.

Collect the transformant and patch on the

ampicillin- resistance LB solid tablet and recultivate

at 37℃.

5) Colony PCR

Dissolve some thalli in 20μL ddH

O, at 95℃ for

10 min. Use the supernatant as the template of PCR.

Table 1: Colony PCR.

Reagents

Dosages

(μL)

Steps Conditions

Hief 5 1 94℃, 5 min

F 0.5 2 94℃, 30 s

R 0.5 3 57℃, 30 s

Template 2 4 72℃, 30 s/kb

ddH

O 2 5

Go to step2 for 33

times more

Up to 10 6 72℃, 10 min

7 16℃, forever

Detect the PCR product by agarose gel, choose the

suspected positive clone strain, inoculate to LB/

Amp+ fluid nutrient medium, at 37℃, and cultivate

overnight. Extract the recombinant plasmids to

sequence the gene.

2.2.2 Acquisition of the Host Bacteria

Activate the S. cerevisiae BJ5464/ p414-TEF1p-

Cas9- CYC1t culture to make competent cells that

will be used as host bacteria.

Select a single colony and place it into 5ml SD

(without tryptophan) liquid culture medium, at 30℃,

and cultivate overnight, until the bacteria solution OD

increases to 3.0-5.0.

After the bacteria solution grows to the expected

OD600, transfer a proper amount of solution into

another 5ml SD (without tryptophan) liquid culture

medium. Set the starting OD600 of the solution

between 0.2 and 0.4, cultivate at 30℃, 200 rpm for

about 4-6 hours. The OD600 should be kept between

0.8-1.0.

Gene Editing of Saccharomyces Cerevisiae Using CRISPR

405

Transfer 1 mL solution to a 1.5 mL centrifuge

tube, centrifuge for 3 min, at normal temperature, at

7000 rpm, and discard all the supernatant.

Wash away the residual medium, prepare 1 mL

wash solution to suspend the bacteria, centrifuge for

3 min, at normal temperature, at 3000 rpm, and

discard all the supernatant.

Prepare 200μL lithium cation solution to suspend

the bacteria, which is the BJ5464- p414- Cas9

competent cells. Sub-package 25μL in each tube, then

either start the transformation of the plasmid or store

it in an ultra-low temperature refrigerator at -80℃.

2.2.3 Transformation of the S. cerevisiae

The donor DNA has been pre-designed. After the

PCR proliferation, use SDS-PAGE to detect if the

plasmids contain the donor sequences. Then purify

the plasmids to get the donor DNA. Mix the plasmids

transformed by gRNA and the donor DNA to

transform the S. cerevisiae. Perform coated-plate

culture and colony PCR, then obtain the transformed

colony.

Donor Primers:

LEU-Donor- F:

TCATCTCCGATGAAGCCTCCGTTATCCCA

GGTTCCTTGGGCATAGCTTCAAAATGTTTC

LEU-Donor-R:

AGTAAGCTACTATGAAAGACTTGTCTGGC

AAAGAGGCCAAGGACGCAGATGGCAACAAA

Table 2. PCR (Amplify the donor fragment)

Reagents

Dosages

(μL)

Steps Conditions

PrimeStar Max

Premix(2x)

25 1 94℃, 2 min

F (20 μM) 0.5 2 98℃, 10 s

R (20 μM) 0.5 3 52℃, 30 s

Template 0.2 4 72℃, 2 min

ddH

O 23.8 5

Go to step2 for 29

times more

Up to 50 6 72℃, 10 min

7 16℃, forever

2.2.4 Acquisition and Detection of the

Products

Cultivate the positive transformant in a tube with

YPD culture medium for 12 h, transfer to a 50 mL

conical flask to cultivate. Control the starting OD600

to be 0.05. Cultivate in 10 mL YPD, at 30℃, at 200

rpm, for 12 h. Place 200μL solution in a black,

transparent 96-pore plate to perform the fluorescence

test.

Excitation wavelength: 485nm.

Emission wavelength: 528nm.

3 RESULTS

Figure 2 represents the p426-pSNR52-gRNA (LEU)-

tSUP4 colony PCR results. It shows the suspected

positive strain.

Figure 1: The plate of p426-pSNR52-gRNA (LEU)-tSUP4.

ICBB 2022 - International Conference on Biotechnology and Biomedicine

406

Figure 2: Results of p426-pSNR52-gRNA (LEU)-tSUP4

colony PCR.

Figure 3: Results of concentration detection of p426-

pSNR52-gRNA (LEU)-tSUP4 plasmid extraction.

Figure 4: Results of BJ5464-p414-Cas9 streaking of the

strain.

This above figure shows the results of the

activated S. cerevisiae.

Figure 5: Results of electrophoresis detection of donor

fragments on the LEU site.

From Figure 5, we can see that the donor sequence

is less than 2000bp.

Figure 6: Results of BJ5464::LEU-pTEF1-YPet-tFBA1

transformant coating.

Figure 6 represents that the colonies have been

transformed to S. cerevisiae.

Figure 7: Results of BJ5464::LEU-pTEF1-YPet-tFBA1

colony PCR.

Gene Editing of Saccharomyces Cerevisiae Using CRISPR

407

From Figure 7, we know the target sequence is

3000bp, so the result numbered 1 in the figure is a

positive stripe.

Figure 8: BJ5464::LEU-pTEF1-YPet-tFBA1.

Figure 8 shows the relative fluorescence value of

BJ5464::LEU-pTEF1-YPet-tFBA1. The result shows

the OD600 is between 3000 and 4000.

4 CONCLUSION

In this experiment, we use the technology of

CRISPR/Cas9 to transform the genetic material of S.

cerevisiae to produce specific fluorescent protein.

The CRISPR/Cas9 system was discovered in the

Streptococcus pyogenes CRISPR pathway, and it is

widely used in research (

Vasu, 2021)

. CRISPR is

also applicable in clinical treatments, with the

challenges and prospects to realize the clinical

potential widely studied. The transformation method

of CRISPR-Cas9 technology is the same as that of

most gene technologies, but due to the specificity of

Cas enzyme, it can successfully bind to the gene chain

at a specific site (Cheng, 2021; Lu, 2015).

CRISPR/Cas9 has the potential in many

application prospects, for example, cancer treatment

(Khajuria, 2021; Wang, 2021), AIDS (Acquired

Immune Deficiency Syndrome) therapies (Xiao,

2019) and cardiac diseases (Schreurs, 2021).

Cancer is one of the major causes of death, and

humans have worked hard to treat it for many years.

CRISPR/Cas9 optimizes the way people usually treat

tumours (Xing, 2020). Experiments have shown that

CRISPR/Cas9 technology can be used to methylate

DNA to alter genetic performance, which is of great

significance for the treatment of many genetic

diseases (Katayama, 2021). Another successful trial

is that researchers from the University of Sichuan,

China, had been able to inject genetically modified

lymphocytes for the first time to a patient with lung

cancer as a therapeutic approach to promote the

immune system's response for eliminating malignant

tumor cells (Castillo, 2016).

AIDS is a disease that seriously threatens human

health. The duplication of HIV (human

immunodeficiency virus) can only be restrained for

the time being. Using CRISPR/Cas9 as an effective

tool to edit the gene is a possible approach to cure

AIDS (Pelletier, 2015).

CRISPR/Cas9 is a technology with great promise.

There have also been successes in treating other

disease. Sickle cell disease is the name for a group of

inherited health conditions that affect the red blood

cells. The most serious type is called sickle cell

anaemia. Researchers successfully induced

hemoglobin for the treatment of sickle cell disease

(SCD) (Demirci, 2021; Philippidis, 2021).

REFERENCES

Castillo Andres. Gene editing using CRISPR-Cas9 for the

treatment of lung cancer. [J].Colombia medica (Cali,

Colombia), 2016,47(4),178-180.

Cheng Hao; Zhang Feng; Ding Yang.CRISPR/Cas9

Delivery System Engineering for Genome Editing in

Therapeutic Applications. [J]. Pharmaceutics, 2021,

13(10).

Demirci Selami; Leonard Alexis; Essawi Khaled; Tisdale

John F..CRISPR-5Cas9 to induce fetal hemoglobin for

the treatment of sickle cell disease [J]. Molecular

Therapy - Methods & Clinical Development, 2021, 23,

276-285.

Katayama Shota; Andou Masao. Editing of DNA

methylation using CRISPR/Cas9 and a ssDNA template

in human cells. [J]. Biochemical and biophysical

research communications,2021,581,20-24.

Khajuria Ocean; Sharma Neha. Epigenetic targeting for

lung cancer treatment via CRISPR/Cas9 technology [J].

Advances in Cancer Biology - Metastasis, 2021,3.

L.S.Q., M.H.L., L.A.G. and X.W. wrote the manuscript.

J. S.W. , W.A.L. an d L. S.Q. supervised the research;

CRISPR interference (CRISPRi) for sequence-specific

control of gene expression. Nat Protoc. 2013 Nov;

8(11): 2180–2196e.

Lu Xiao-Jie, Xue Hui-Ying, Ke Zun-Ping, Chen Jin-Lian,

Ji Li-Juan.CRISPR-Cas9: a new and promising player

in gene therapy[J].Journal of Medical Genetics, 2015,

52(5).

Luyao Wang, Yurong Chen, [...], and Xiangpeng Dai; The

Application of CRISPR/Cas9 Technology for Cancer

Immunotherapy: Current Status and Problems. Front

Oncol. 2021; 11: 704999.

ICBB 2022 - International Conference on Biotechnology and Biomedicine

408

Pelletier Stephane, Gingras Sebastien, Green Douglas

R.Mouse genome engineering via CRISPR-Cas9 for

study of immune function.[J].Immunity,2015,42(1),18-

27.

Philippidis Alex.CRISPR-Cas9 Gene-Edited Therapy

Shows Sustained Treatment Response. [J]. Human gene

therapy,2021,32(13-14),642-644.

Qiaoqiao Xiao, Deyin Guo, and Shuliang Chen;

Application of CRISPR/Cas9-Based Gene Editing in

HIV-1/AIDS Therapy. Front Cell Infect Microbiol.

2019; 9: 69.

Schreurs Juliët; Sacchetto Claudia; Colpaert Robin M. W.;

Vitiello Libero; Rampazzo Alessandra; Calore Martina.

Recent Advances in CRISPR/Cas9-Based Genome

Editing Tools for Cardiac Diseases [J]. International

Journal of Molecular Sciences, 2021, 22(20), 10985-

10985.

Vasu Kommireddy; Fox Paul L.Screening of CRISPR-

Cas9-generated point mutant mice using MiSeq and

locked nucleic acid probe PCR.[J].STAR protocols,

2021,2(4), 100785-100785.

Xuebing Wu; Andrea J. Kriz; Phillip A. Sharp. Target

specificity of the CRISPR-Cas9 system [J].

Quantitative Biology, 2014,2(2),59-70.

Xing Hui, Meng Ling hua.CRISPR-cas9: a powerful tool

towards precision medicine in cancer treatment[J].Acta

Pharmacologica Sinica,2020,41(5), 583-587.

Yan Rihui; Lin Xianwu. CRISPR/Cas9-Mediated Genome

Editing System in Insect Genomics and Pest

Management. [J]. Methods in molecular biology

(Clifton, N.J.), 2022,2360,347-366.

Gene Editing of Saccharomyces Cerevisiae Using CRISPR

409