Heterologous Expression of Fluorescent Protein Gene in E. Coli

DH5α

Yilin Li

1,*

and Chenyu Yang

Biomedical Science Department, Southern University of Science and Technology, No. 1088, Xueyuan Avenue, Nanshan

District, Shenzhen, China

Queen Mary College, Nanchang University, the Medical College, Block C, No. 999, Xuefu Avenue, Honggutan New

District, Nanchang, China

Keywords:

Gene Editing, E. Coli, Plasmid, Fluorescent Protein.

Abstract: Gene editing has opened a new field of molecular genetics research and the door for humans to understand,

identify, isolate and modify genes to create new species. This project aims to produce heterologous fluorescent

protein in E. coli cells by gene editing. By PCR amplification, the fluorescent protein gene has been obtained

from the plasmid carrier; the target gene has been connected to the carrier, and finally transformed into the

clone vector. The results of this project show that the fluorescent protein expressed by E. coli can be obtained,

and the heterologous protein gene can be expressed in E. coli.

1 INTRODUCTION

Gene editing is an emerging technology that modifies

specific target genes in an organism’s genome. It can

efficiently carry out site-specific genome editing,

showing great potential in gene research, gene

therapy and genetic improvement. The rapid growth

of the human population increases the demand for

meat and dairy products speedily, which drives the

demand for crops, biofuels and livestock. It is an

urgent problem to consider how to improve the

effective yield of major crops The gene-editing

technology can significantly improve crop yield by

increasing plant resistance and improving crop

quality to meet human needs (Ahmar, 2020).

Genome editing to correct disease-causing

mutations is a promising way to treat human diseases.

Gene editing-based therapy has the potential to treat

more than 10,000 human single-gene diseases such as

sickle cell disease (Park, 2021), and benefit many

more complex diseases (Memi, 2018). Research

shows that gene editing has also achieved results in

treating cancer and AIDS.

As a simple and programmable nuclease-based

genome-editing tool, the clustered regularly spaced

short palindromic repeats (CRISPR)/CRISPR-

associated protein 9 (Cas9) system dramatically

improves the ability to make precise changes in the

human genome. In recent years, rapid advances in

CRISPR-based technologies have expanded their

reach and promoted CRISPR-based therapies in

preclinical trials (Cui, 2018). The number of gene

therapy drugs has increased rapidly, showing

significant therapeutic effects on some cancers,

genetic diseases and infectious diseases, especially

after the emergence of the CRISPR technology in

2013.

E. coli is an essential tool in gene-editing

technology. It can be transformed into a variety of

functions and uses of cell factories, to achieve

enzymes production, monoclonal antibodies, etc. It

can also be used to catalyze biological and chemical

reactions, synthesize complex compound molecules

difficult to be synthesized before, and accelerate the

creation and development of new drugs.

Researchers have isolated a variety of fluorescent

proteins from living organisms, using molecular

biology techniques to evolve mutants that cover

almost the entire fluorescence spectrum. The red

fluorescent protein mCherry and green fluorescent

protein GFP are widely used. They have good

characteristics in fluorescence intensity, light

stability, acid-base resistance, maturity rate and other

aspects. They can be used as fusion protein labels and

applied in multi-fluorescent labelling imaging

systems.

410

Li, Y. and Yang, C.

Heterologous Expression of Fluorescent Protein Gene in E. Coli DH5α.

DOI: 10.5220/0012025200003633

In Proceedings of the 4th International Conference on Biotechnology and Biomedicine (ICBB 2022), pages 410-418

ISBN: 978-989-758-637-8

 2023 by SCITEPRESS – Science and Technology Publications, Lda. Under CC license (CC BY-NC-ND 4.0)

This project is based on gene-editing technology.

In this project, the fluorescent protein gene is

integrated onto prSFDUET-1 plasmid by the

homologous recombination technique, and the

recombinant plasmid is transformed into E. coli

BL21(DE3) cells. The fluorescent protein gene is

expressed in E.coli by induction, and the size of the

expressed protein is identified by SDS-PAGE.

2 MATERIALS AND METHODS

2.1 PCR Amplification of the Target

Gene

2.1.1 Reagents

Plasmids:

pRSFDuet-1, pET30a-mCherry, YEp181-TEF1-

GFP-FBA1.

Polymerases:

PrimeSTAR® Max DNA Polymerase enzyme,

Hieff® Taq DNA Polymerase.

Primers:

GY-mCherry-F: 5'-

TAATAAGGAGATATACCATGGTTTCCAAGG

GCGAGGAG-3';

GY-mCherry-R: 5'-

TCTGTTCGACTTAAGCATTACTTGTAGAGTT

CGTCCATG-3';

GY-GFP-F: 5'-

TAATAAGGAGATATACCATGCGTAAAGGAG

AAGAACTT-3';

GY-GFP-R: 5'-

TCTGTTCGACTTAAGCATTATTTGTATAGTTC

ATCCATGCCAT-3';

GY-bb-F: 5'-

TAATGCTTAAGTCGAACAGAAAGTAAT-3';

GY-bb-R: 5'-

CATGGTATATCTCCTTATTAAAGTTAAA-3'.

Others:

ddH

O, agarose, 1×TAE buffer, 5×loading

marker, DNA marker.

2.1.2 Materials

PCR tube (sterilized);

1.5 mL centrifuge tube (sterilized).

2.1.3 Apparatus

PCR machine, horizontal electrophoresis

2.1.4 Procedures

1) Miniprep plasmid (templates of PCR)

2) Single digestion of plasmid

3) Agarose gel detection of plasmid

4) PCR Reaction

Table 1: Reaction system: PCR Mixture in PCR tube.

Primestar polymerase 15 µL

Primer F 1.2 µL

Primer R 1.2 µL

plasmid template <10ng

ddH

O Up to 30 µL

total volume 30 µL

Calculate the number of volumes to be added for

pET30a-mCherry, pRSFDuet-1 and YEp181-TEF1-

GFP-FBA1 according to each reagent in the system

(ng/μL). Dosages are added to the PCR tubes in

descending order. Mix the reactants in a centrifuge

tube. Centrifugate for 5 s. Place the reaction tube into

the sample hole in the base of the PCR instrument, set

up the program, and conduct the PCR reaction:

Table 2: PCR Reaction Steps.

Preheat 94 ℃ 2 min

Denaturation 98 ℃ 10 s

Annealing 49 ℃ 5 s

Stretching 72 ℃ 40 s (10 s/kb)

Renaturation 72 ℃ 10 min

End 16 ℃ forever

Perform the denaturation, annealing and

extension cycles for 30 times. Then identify the

products of the PCR reaction.

The PCR products are identified whether

amplified or not by the pre-prepared 2% agarose gel

electrophoresis. Record the sequence of dot sampling

at 120 V and for 20 min as below.

Sampling: 4 μL PCR product + 1 μL 5× loading

buffer;

DNA marker: 5 mL;

2% agarose gel: 0.2 g agarose + 20 mL 1× TAE

buffer

The amplified product sizes: GFP (751 bp),

mCherry (711 bp), backbone (3745 bp).

The PCR products are purified and then stored in

a refrigerator at 4 ℃.

Heterologous Expression of Fluorescent Protein Gene in E. Coli DH5α

411

2.2 Double Fragment Homologous

Recombination

2.2.1 Recombination System Configuration

Carrier backbone=0.02×3745 bp=75 ng.

Fragment mCherry=0.04×711 bp=32 ng,

GFP=0.04×718 bp=32 ng

Table 3: ①pRSF-mCherry recombination.

System 20 μL

carrier backbone 75 ng

fragment mCherry 32 ng

5×CE II Buffer 4 µL

Exnase II 2 µL

ddH

O up to 20 µL

total volume 20 µL

Table 4: ②pRSF-GFP recombination.

System 20 μL

carrier backbone 75 ng

fragment GFP 32 ng

5×CE II Buffer 4 µL

Exnase II 2 µL

ddH

O up to 20 µL

total volume 20 µL

2.2.2 Recombination Reaction

The reaction takes place in a metal bath at 37 ℃ for

30 min, then the reagents are immediately placed on

ice for 5 min.

2.3 Transformation of the

Recombinant DNA Mixture into E.

Coli DH5Α Receptor Cells

2.3.1 Procedures

20 µL E. coli DH5α competent cells are removed

from a refrigerator at -80 ℃ and placed on an ice box.

Defrost at room temperature and are marked.

Add 5 µL of the recombinant system to the

competent cells, mix well, and take an ice bath for 30

min.

Recovery: operate heat shock for 90 s in a water

bath at 42 ℃, and then immediately place on the ice

box for 3 min.

Add 800 µL LB medium to each tube and culture

at 180 rpm, at 37 ℃, for 1 h.

Add 150 µL conversion solution to the

corresponding resistant (50 ng/µL kanamycin) plate

and evenly coat it with the liquid.

Place the plate upside-down in a constant-

temperature incubator at 37 ℃ for overnight

culturing.

2.4 Screening of Positive Clones by

Colony PCR

2.4.1 Materials

Conversion board, Hieff® Taq DNA Polymerase,

ddH

O, agarose, 1×TAE buffer, 5×loading marker,

DNA marker, PCR tubes (sterilized).

Primers:

GY-mCherry-F:5'-

TAATAAGGAGATATACCATGGTTTCCAAGG

GCGAGGAG-3'

GY-GFP-F:5'-

TAATAAGGAGATATACCATGCGTAAAGGAG

AAGAACTT-3'Carrier (0.5 μL)

Seq-GY(-R):5'-TTCGATTATGCGGCCGTG-3'

2.4.2 Procedures

Remove the plate transformed the night before from

the 37℃ incubator and draw a pat line.

Patch and amplify the bacterium colony.

Single colonies are enriched and cultured at 37 ℃

for 5-7 h after 20 µL ddH

O is added into the PCR

tube, and the bacteria coating is scraped into the PCR

tube at a ultra-clean table, with one tube for each

bacterium. After the thallus is fully dissolved in

ddH

O, the thallus DNA is released into the water by

lysis at 98 ℃ for 10 min. Centrifuge for 5 min, with

the supernatant used as the template DNA of the

colony PCR.

The following PCR systems are prepared.

Table 5: PCR Systems for Screening.

2×Hieff premix DNA

Polymerase

5 μL

Primer F 0.4 µL

Primer R 0.4 µL

Template 2 µL

ddH

O up to 10 µL

total volume 10 µL Mix

Mix and centrifuge the reactants for 5 s.

ICBB 2022 - International Conference on Biotechnology and Biomedicine

412

Place the reaction tube into the sample hole in the

base of the PCR instrument, set up the program, and

conduct the PCR reaction.

Table 6: PCR Reaction Steps.

Preheat 94 ℃ 5 min

Denaturation 94 ℃ 30 s

Annealing 58 ℃ 30 s

Stretching 72 ℃ 30 s (30 s/kb)

Renaturation 72 ℃ 10 min

End 16 ℃ forever

Perform the denaturation, annealing and

extension cycles for 30 times. The PCR products are

subjected to the pre-prepared 2% agarose gel

electrophoresis to identify whether the target products

are amplified. Record the sequence of the spot

sampling at 120 V and for 20 min.

Spot sample: 5 μL colony PCR product, DNA

marker 5 μL.

2% agarose gel: 0.2 g agarose + 20 mL 1× TAE

buffer.

The amplified product sizes: GFP positive

bacteria (785 bp), mCherry positive bacteria (779 bp).

2.5 Miniprep of Plasmid DNA

The colony PCR-verified positive strains are

inoculated into LB/K+ medium for overnight

culturing at 220 rpm at 37 ℃. Plasmid DNA is

extracted.

2.6 Enzyme Validation

The plasmid DNA is cleaved by a restriction

endonuclease.

2.6.1 Enzyme Digestion System

At 37 ℃ enzyme for 30 min.

Table 7: Enzyme digestion system.

system 10 μL

10×FastDigest buffer 1 µL

NcoI 0.2 µL

XhoI 0.2 µL

Template 500 ng

ddH

O Up to 10 µL

2.6.2 Identification of Enzyme Digestion

Results

The cleavage product bands of pRSF-GFP are

745+3711bp.

The cleavage product bands of pRSF-mCherry are

906+3544bp.

2.7 Plasmid DNA Transformed into E.

Coli BL21(DE3) Competent Cells

When the sequencing results are correct, the plasmid

DNA is transformed into E. coli BL21(DE3)

competent cells expressing the host.

2.8 mCherry/GFP Expression in E.

Coli BL21 (DE3) Induced by IPTG

2.8.1 Materials and Instruments

E. coli BL21 (DE3) containing pRSF-GFP plasmid,

E. coli BL21 (DE3) containing PRSF-mCherry

plasmid, LB/K+ solid and liquid medium, 1M IPTG

storage solution, kanamycin storage solution, 20mM

Tris-HCl buffer, 50ml, 2ml, 1.5ml centrifuge tubes,

pipette gun and head, hood spectrophotometer, low-

temperature centrifuge, ultra-clean table,

spectrophotometer.

2.8.2 Procedures

Strains containing recombinant plasmid are streaked

on LB plates containing kanamycin and cultured

overnight.

Single colonies are selected into about 5 mL LB

medium containing kanamycin and cultured

overnight at 37 ℃ and 220 rpm to obtain seed liquid.

The seeds are inoculated at 1:50 in 50 mL LB

medium containing kanamycin and cultured at 37 ℃

and 220 rpm for 1-1.5 h.

When OD600 is between 0.5 and 0.7, 25 µL IPTG

is added and induced at 180rpm, at 30 ℃ for 7 h.

Observe the colour of the solution.

After the induction, the bacterial solution OD is

measured, and the induced bacterial solution is

transferred to a 50 mL centrifuge tube. After being

centrifuged at 1340rpm for 30 min at low

temperature, the supernatant is discarded, and the

colour of the thallus is observed and photographed.

Resuspend with the buffer until 10OD/mL. Place 1 ml

of the sample on ice to be treated with an ultrasonic

crusher for 7 min (power 20%, 3 s each time. Interval

3 s).

Centrifuge at 12000 rpm for 10 min, transfer the

supernatant to another centrifuge tube, and precipitate

1 mL phase. Resuspend with the buffer. Add 80µL

supernatant or precipitate solution into the 1.5 mL

centrifuge tube, add 20µL 5× protein loading buffer

Heterologous Expression of Fluorescent Protein Gene in E. Coli DH5α

413

and mix evenly. Boil for 5 min at 100 ℃. Cool and

set aside at -20 ℃.

2.9 SDS-PAGE

2.9.1 Procedures

Preparation of protein gel.

Table 8. SDS-PAGE Gel formula

12% separation gel 5% stacking gel

Reagent

Volu

Reagent Volume

ddH

3.3

ddH

O 2.2 mL

30%(w/v)

polyacrylam

ide

4 mL

30%(w/v)

polyacrylam

ide

0.67 mL

1.5 M Tris-

HCl(pH8.8)

2.5

1.5 M Tris-

HCl(pH8.8)

1.0 mL

10% SDS

100

μL

10% SDS 40 μL

10% APS

100

μL

10% APS 40 μL

TEMED 6 μL TEMED 4 μL

Fix the gel glass plate on the electrophoresis

device and add trIS-glycine electrophoresis buffer in

the upper and lower tanks. Add the samples in

sequence, 10 µL solution for each aperture. Add an

equal volume of 1×SDS gel loading buffer to the

unused sample well.

Connect the electrophoresis device with the

power supply (positive electrode slot) and apply 90 V

on the gel. After the dye front enters the separation

glue, the voltage is increased to 120 V. The

electrophoresis continue until the bromophenol blue

reaches the bottom of the separation glue, and then

the power is turned off.

Remove the glass plate from the electrophoresis

device and carefully pry the glass plate.

Soak the gel in at least 5 times the volume of

dyeing solution and gently shake it on the

decolorizing shaker for at least 0.5 h.

Remove the dye. Soak the gel in the

decolorization solution, gently shake for 1-2 hours,

changing the decolorization solution 4 times.

3 RESULTS

3.1 Recombinant DNA

After the recombinant DNA is transformed into the

DH5α cells, the transformants on the plate are tested

by colony PCR.

Figure 1: Colony PCR gel map.

Figure 1 shows that the colony is a positive colony

containing the target gene.

3.2 Plasmid Verification

To further verify whether the extracted plasmid DNA

is a positive clone, we cut the plasmid DNA using

restriction endonuclease to detect whether the target

band size is correct.

Figure 2: Enzyme digestion validation.

ICBB 2022 - International Conference on Biotechnology and Biomedicine

414

The results of enzyme digestion are correct

(Figure 2); the plasmid and primer (SEQ-Gy) are

sequenced and each identified by 4μL.

(a) dhwefhohc.

(b) fhrjfh.

Figure 3: Sequencing analysis.

Sequencing results show that mCherry is correct,

and there is a base mutation after the GFP starts codon

ATG. A) dhwefhohc. B) fhrjfh.

3.3 Fluorescence

IPTG is used as an inducer to induce the promoter

controlled by lactose operon to ensure stable

Heterologous Expression of Fluorescent Protein Gene in E. Coli DH5α

415

expression of heterologous protein in the condition of

good growth of E.coli and avoid the influence of a

large amount of heterologous protein expression on

the growth of E.coli.

(a) GFP and mCherry before induction (b) mCherry after induction (c) bacteria mCherry and GFP

Figure 4: Results of fluorescence.

Figure 5: Results of SDS-PAGE.

3.4 SDS-PAGE of mCherry and GFP

protein

The molecular weights of the products are verified by

SDS-PAGE protein polyacrylamide gel

electrophoresis.

ICBB 2022 - International Conference on Biotechnology and Biomedicine

416

4 CONCLUSION

This project demonstrates the basic operation model

of genetic engineering. The fluorescent protein gene

is integrated into the pRSFDuet-1 plasmid by

homologous recombination technology, and the

resulting recombinant plasmid is transformed into

E.coli BL21(DE3) cells, and the fluorescent protein

gene is expressed in E.coli by induction.

4.1 The Future of Gene Editing

The number of mutations in somatic cells increases

dramatically with age, some of which can lead to

cancer. In the future, gene-editing technology may

help modify specific regions of the genome to

prevent disease development.

In addition, the development of efficient genome-

editing tools, including base editors with high

specificity and no off-target effects, will open the

possibility of using them in human embryos to avoid

the spread of disease-causing mutations. Similarly,

newly developed CRISPR-free mitochondrial base-

editing methods are expected to correct pathogenic

mutations in mtDNA present in unfertilized oocytes

or embryos in the future and prevent transmission of

mitochondrial disease to the next generation (Li,

2020).

Genetic diseases are not only caused by mutations

in genes but also caused by low expression of the said

genes, thus affecting the function of tissues and

organs. During ageing, dysregulation of epigenetic

markers results in reduced expression of several

different genes that are important for the proper

functioning of cells and tissues, ultimately leading to

disease.

Since customizable nucleases have been shown to

regulate the expression of target genes without

modifying the genome sequence, they could be used

to treat a variety of diseases, improve cellular

characteristics of ageing, and restore tissue functions

(Reddy, 2020).

One of the major challenges in cancer

immunotherapy is targeting cancer cells specifically

while keeping healthy cells unharmed. Targeting

immune checkpoints through gene editing has been

shown to be a possible strategy (Ernst, 2020). In

treating primary tumors, targeted knockout can be

applied to viral infections such as HPV, which means

efficient gene knockout is required to reduce tumors

effectively. Targeting viral sequences rather than

endogenous genomic locations may be an advantage

to reduce the risk of unwanted genomic changes due

to gene editing. This could also be the potential

advantage of strategies to eradicate pre-HIV viruses

from the genome. HIV infection causes the body to

build up a dormant reservoir of proviruses, making it

much more difficult to cure (Wayengera, 2011). The

removal or destruction of HIV genes in vivo by

vector transport endonuclease can eliminate the

innate adaptive replication and survival of HIV and

provide an opportunity to prevent HIV gene

replication.

The way genome editing works presents a double-

edged sword: while it offers unprecedented

therapeutic benefits, it also has safety concerns.

Because a gene-editing therapy works by

producing DSBs in genomic DNA, the risk of

missing the target at an unintended site is higher than

that of another therapy that does not induce

chromosome insertion or genomic changes (Shim,

2017). Because therapeutic gene targeting strongly

relies on the creation of DSB at specific targets, in

vitro selection libraries (Guilinger, 2014), mismatch

detection nuclease assays (Vouillot, 2015), and

whole-genome sequencing (Gabriel, 2011) have been

developed to assess the targeting specificity of

nucleases. Studies have shown that base editors

(BEs) composed of a cytidine deaminase fused to

CRISPR/Cas9 enables efficient RNA-guided base

editing (Kim, 2017), which improve the efficiency of

nuclease editing. There is also the challenge of

developing efficient and safe methods to deliver

gene-editing elements to cells in the body. Existing

delivery methods, such as lipid nanoparticles

(Gilleron, 2013), are widely used. This method is safe

and simple but inefficient. In contrast, viral vectors

such as adenoviruses (Holkers, 2013) have higher

delivery efficiency, but there are unintentional

mutations and safety issues (Silva, 2011).

Moreover, unlike chemicals and antibody drugs,

gene-editing therapies require people to select

relevant animal models for safety studies. For in-vivo

gene-editing therapies, the binding specificity of the

designed nuclease is controlled by specific sequences

in the genome. Because the mouse genome is

substantially different from the human genome,

preclinical safety studies should instead be conducted

in animal models that mimic the human genome.

REFERENCES

Ahmar S, Saeed S, Khan MHU, Ullah Khan S, Mora-

Poblete F, Kamran M, Faheem A, Maqsood A, Rauf M,

Saleem S, Hong WJ, Jung KH. A Revolution toward

Gene-Editing Technology and Its Application to Crop

Improvement. Int J Mol Sci. 2020 Aug 7;21(16):5665.

Heterologous Expression of Fluorescent Protein Gene in E. Coli DH5α

417

doi: 10.3390/ijms21165665. PMID: 32784649;

PMCID: PMC7461041.

Cui Zhang, Renfu Quan, Jinfu Wang, Development and

application of CRISPR/Cas9 technologies in genomic

editing, Human Molecular Genetics, Volume 27, Issue

R2, 01 August 2018, Pages R79–R88,

https://doi.org/10.1093/hmg/ddy120.

Ernst, Martijn P T et al. “Ready for Repair? Gene Editing

Enters the Clinic for the Treatment of Human Disease.”

Molecular therapy. Methods & clinical development

vol. 18 532-557. 3 Jul. 2020,

doi:10.1016/j.omtm.2020.06.022.

Gabriel, R., Lombardo, A., Arens, A., Miller, J. C.,

Genovese, P., Kaeppel, C., Nowrouzi, A.,

Bartholomae, C. C., Wang, J., Friedman, G., Holmes,

M. C., Gregory, P. D., Glimm, H., Schmidt, M.,

Naldini, L., & von Kalle, C. (2011). An unbiased

genome-wide analysis of zinc-finger nuclease

specificity. Nature biotechnology, 29(9), 816–823.

https://doi.org/10.1038/nbt.1948.

Guilinger, J. P., Pattanayak, V., Reyon, D., Tsai, S. Q.,

Sander, J. D., Joung, J. K., & Liu, D. R. (2014). Broad

specificity profiling of TALENs results in engineered

nucleases with improved DNA-cleavage specificity.

Nature methods, 11(4), 429–435.

https://doi.org/10.1038/nmeth.2845.

Gilleron, J., Querbes, W., Zeigerer, A., Borodovsky, A.,

Marsico, G., Schubert, U., Manygoats, K., Seifert, S.,

Andree, C., Stöter, M., Epstein-Barash, H., Zhang, L.,

Koteliansky, V., Fitzgerald, K., Fava, E., Bickle, M.,

Kalaidzidis, Y., Akinc, A., Maier, M., & Zerial, M.

(2013). Image-based analysis of lipid nanoparticle-

mediated siRNA delivery, intracellular trafficking and

endosomal escape. Nature biotechnology, 31(7), 638–

646. https://doi.org/10.1038/nbt.2612.

Holkers, M., Maggio, I., Liu, J., Janssen, J. M., Miselli, F.,

Mussolino, C., Recchia, A., Cathomen, T., &

Gonçalves, M. A. (2013). Differential integrity of

TALE nuclease genes following adenoviral and

lentiviral vector gene transfer into human cells. Nucleic

acids research, 41(5), e63.

https://doi.org/10.1093/nar/gks1446.

Kim, K., Ryu, S. M., Kim, S. T., Baek, G., Kim, D., Lim,

K., Chung, E., Kim, S., & Kim, J. S. (2017). Highly

efficient RNA-guided base editing in mouse embryos.

Nature biotechnology, 35(5), 435–437.

https://doi.org/10.1038/nbt.3816.

Li, H., Yang, Y., Hong, W., Huang, M., Wu, M., & Zhao, X.

(2020). Applications of genome editing technology in

the targeted therapy of human diseases: mechanisms,

advances and prospects. Signal transduction and

targeted therapy, 5(1), 1.

https://doi.org/10.1038/s41392-019-0089-y.

Memi F, Ntokou A, Papangeli I. CRISPR/Cas9 gene-

editing: Research technologies, clinical applications

and ethical considerations. Semin Perinatol. 2018

Dec;42(8):487-500. doi:

10.1053/j.semperi.2018.09.003. Epub 2018 Oct 2.

PMID: 30482590.

Park SH, Bao G. CRISPR/Cas9 gene editing for curing

sickle cell disease. Transfus Apher Sci. 2021

Feb;60(1):103060. doi: 10.1016/j.transci.2021.103060.

Epub 2021 Jan 10. PMID: 33455878; PMCID:

PMC8049447.

Reddy P, Vilella F, Izpisua Belmonte JC, Simón C. Use

of Customizable Nucleases for Gene Editing and

Other Novel Applications. Genes (Basel). 2020 Aug

22;11(9):976. doi: 10.3390/genes11090976. PMID:

32842577; PMCID: PMC7565838.

Shim, Gayong et al. “Therapeutic gene editing: delivery

and regulatory perspectives.” Acta pharmacologica

Sinica vol. 38,6 (2017): 738-753.

doi:10.1038/aps.2017.2.

Silva, G., Poirot, L., Galetto, R., Smith, J., Montoya, G.,

Duchateau, P., & Pâques, F. (2011). Meganucleases and

other tools for targeted genome engineering:

perspectives and challenges for gene therapy. Current

gene therapy, 11(1), 11–27.

https://doi.org/10.2174/156652311794520111.

Vouillot, L., Thélie, A., & Pollet, N. (2015). Comparison of

T7E1 and surveyor mismatch cleavage assays to detect

mutations triggered by engineered nucleases. G3

(Bethesda, Md.), 5(3), 407–415.

https://doi.org/10.1534/g3.114.015834.

Wayengera, Misaki. “Proviral HIV-genome-wide and pol-

gene specific zinc finger nucleases: usability for

targeted HIV gene therapy.” Theoretical biology &

medical modelling vol. 8 26. 22 Jul. 2011,

doi:10.1186/1742-4682-8-26.

ICBB 2022 - International Conference on Biotechnology and Biomedicine

418